EMAIL THIS PAGE TO A FRIEND

DPP4

dipeptidyl-peptidase 4

146 Gene Product Result for
Synonyms: ADABP ADCP2 CD26 DPPIV TP103
UniProtKB ID: P27487, Q53TN1
Gene ID:
Human(1803) Summary: The protein encoded by this gene is identical to adenosine deaminase complexing protein-2, and to the T-cell activation antigen CD26. It is an intrinsic membrane glycoprotein and a serine exopeptidase that cleaves X-proline dipeptides from the N-terminus of polypeptides. [provided by RefSeq, Jul 2008]
Mouse(13482) dipeptidylpeptidase 4
Rat(25253) dipeptidylpeptidase 4
domestic guinea pig(100721104) dipeptidyl-peptidase 4
naked mole-rat(101722925) dipeptidyl-peptidase 4
sheep(100170324) dipeptidyl-peptidase 4
Domestic Rabbit(100341424) dipeptidyl-peptidase 4
Zebrafish(100301982) dipeptidyl-peptidase 4
cow(281122) dipeptidyl-peptidase 4
Horse(100061124) dipeptidyl-peptidase 4
domestic cat(493787) dipeptidyl-peptidase 4
chicken(424187) dipeptidyl-peptidase 4
dog(478767) dipeptidyl-peptidase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
D1445 Anti-DPP4 (61-75) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2900184 Anti-DPP4 (AB1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
SAB2900185 Anti-DPP4 (AB2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
GW21442 Anti-DPP4 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, rat, mouse
immunocytochemistry, western blot pricing
SAB2500328 Anti-DPP4/CD26 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, rat, canine, mouse
ELISA, western blot pricing
SAB4700252 Monoclonal Anti-CD26 antibody produced in mouse clone BA5b, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700253 Monoclonal Anti-CD26-APC antibody produced in mouse clone BA5b, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700254 Monoclonal Anti-CD26-FITC antibody produced in mouse clone BA5b, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700255 Monoclonal Anti-CD26-PE antibody produced in mouse clone BA5b, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
WH0001803M3 Monoclonal Anti-DPP4 antibody produced in mouse clone 1C5, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A6671 Actinonin human pricing
482609 N-[(2S,3R)-3-Amino-2-hydroxy-4-phenylbutyryl]-L-leucine 97% human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010074 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010074 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010074 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001935 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001935 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001935 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001935 Rosetta Predictions human pricing
NM_012789 Rosetta Predictions rat pricing
NM_010074 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001935 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098446 predicted 1862
2 SASI_Hs02_00332836 predicted 1454
3 SASI_Hs01_00098447 predicted 1394
4 SASI_Hs01_00098448 predicted 2239
5 SASI_Hs01_00098449 predicted 1593
6 SASI_Hs01_00098450 predicted 1570
7 SASI_Hs01_00098451 predicted 1146
8 SASI_Hs01_00098452 predicted 1783
9 SASI_Hs01_00098453 predicted 1309
10 SASI_Hs02_00332837 predicted 1057
11 SASI_Hs01_00098454 predicted 2548
12 SASI_Hs01_00098455 predicted 2444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012789 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075570 predicted 607
2 SASI_Rn01_00075572 predicted 1766
3 SASI_Rn02_00260210 predicted 2095
4 SASI_Rn01_00075574 predicted 1074
5 SASI_Rn01_00075576 predicted 2444
6 SASI_Rn02_00260211 predicted 1598
7 SASI_Rn01_00075577 predicted 1168
8 SASI_Rn01_00075578 predicted 2124
9 SASI_Rn01_00075579 predicted 1707
10 SASI_Rn02_00260212 predicted 2332
11 SASI_Rn01_00075571 predicted 1581
12 SASI_Rn01_00075573 predicted 1332
13 SASI_Rn01_00075575 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010074 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091871 predicted 1957
2 SASI_Mm02_00317754 predicted 986
3 SASI_Mm01_00091873 predicted 1765
4 SASI_Mm01_00091874 predicted 1516
5 SASI_Mm01_00091875 predicted 872
6 SASI_Mm01_00091876 predicted 1637
7 SASI_Mm01_00091878 predicted 2164
8 SASI_Mm01_00091879 predicted 1268
9 SASI_Mm01_00091880 predicted 2528
10 SASI_Mm02_00317755 predicted 786
11 SASI_Mm01_00091872 predicted 466
12 SASI_Mm01_00091877 predicted 2331
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010074
DPP4 MISSION shRNA Bacterial Glycerol Stock
dipeptidyl-peptidase 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000452871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010074.3-1537s21c1
Sequence:CCGGATAAGATCATCAGCGACAAAGCTCGAGCTTTGTCGCTGATGATCTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010074.3-2730s21c1
Sequence:CCGGATAGCTCTCCATAGCTTATTTCTCGAGAAATAAGCTATGGAGAGCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010074.3-1785s21c1
Sequence:CCGGCAGTATTATGCGGTATCATTTCTCGAGAAATGATACCGCATAATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010074.2-986s1c1
Sequence:CCGGGCTCATTGAATACTCCTTCTACTCGAGTAGAAGGAGTATTCAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010074.2-421s1c1
Sequence:CCGGCGTATTCACTAGCTGACTATTCTCGAGAATAGTCAGCTAGTGAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010074.2-1894s1c1
Sequence:CCGGCCAAGAAATATCCTCTACTATCTCGAGATAGTAGAGGATATTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010074.2-2478s1c1
Sequence:CCGGGCAATGTGGTACACGGATGAACTCGAGTTCATCCGTGTACCACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010074.2-2057s1c1
Sequence:CCGGGCATGCAATCAACAGAAGATTCTCGAGAATCTTCTGTTGATTGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010074
DPP4 MISSION shRNA shRNA Plasmid DNA
dipeptidyl-peptidase 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000452871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010074.3-1537s21c1
Sequence:CCGGATAAGATCATCAGCGACAAAGCTCGAGCTTTGTCGCTGATGATCTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010074.3-2730s21c1
Sequence:CCGGATAGCTCTCCATAGCTTATTTCTCGAGAAATAAGCTATGGAGAGCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010074.3-1785s21c1
Sequence:CCGGCAGTATTATGCGGTATCATTTCTCGAGAAATGATACCGCATAATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010074.2-986s1c1
Sequence:CCGGGCTCATTGAATACTCCTTCTACTCGAGTAGAAGGAGTATTCAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010074.2-421s1c1
Sequence:CCGGCGTATTCACTAGCTGACTATTCTCGAGAATAGTCAGCTAGTGAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010074.2-1894s1c1
Sequence:CCGGCCAAGAAATATCCTCTACTATCTCGAGATAGTAGAGGATATTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010074.2-2478s1c1
Sequence:CCGGGCAATGTGGTACACGGATGAACTCGAGTTCATCCGTGTACCACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010074.2-2057s1c1
Sequence:CCGGGCATGCAATCAACAGAAGATTCTCGAGAATCTTCTGTTGATTGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010074
DPP4 MISSION shRNA Lentiviral Transduction Particles
dipeptidyl-peptidase 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000452871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010074.3-1537s21c1
Sequence:CCGGATAAGATCATCAGCGACAAAGCTCGAGCTTTGTCGCTGATGATCTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010074.3-2730s21c1
Sequence:CCGGATAGCTCTCCATAGCTTATTTCTCGAGAAATAAGCTATGGAGAGCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010074.3-1785s21c1
Sequence:CCGGCAGTATTATGCGGTATCATTTCTCGAGAAATGATACCGCATAATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010074.2-986s1c1
Sequence:CCGGGCTCATTGAATACTCCTTCTACTCGAGTAGAAGGAGTATTCAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010074.2-421s1c1
Sequence:CCGGCGTATTCACTAGCTGACTATTCTCGAGAATAGTCAGCTAGTGAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010074.2-1894s1c1
Sequence:CCGGCCAAGAAATATCCTCTACTATCTCGAGATAGTAGAGGATATTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010074.2-2478s1c1
Sequence:CCGGGCAATGTGGTACACGGATGAACTCGAGTTCATCCGTGTACCACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010074.2-2057s1c1
Sequence:CCGGGCATGCAATCAACAGAAGATTCTCGAGAATCTTCTGTTGATTGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001935
DPP4 MISSION shRNA Bacterial Glycerol Stock
dipeptidyl-peptidase 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001935.3-1943s21c1
Sequence:CCGGTCAGTAAAGAGGCGAAGTATTCTCGAGAATACTTCGCCTCTTTACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001935.3-689s21c1
Sequence:CCGGACACTCTAACTGATTACTTAACTCGAGTTAAGTAATCAGTTAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001935.3-1031s21c1
Sequence:CCGGGGTCACCAGTGGGTCATAAATCTCGAGATTTATGACCCACTGGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001935.2-786s1c1
Sequence:CCGGGCCCAATTTAACGACACAGAACTCGAGTTCTGTGTCGTTAAATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001935.2-2136s1c1
Sequence:CCGGCCAGAAGACAACCTTGACCATCTCGAGATGGTCAAGGTTGTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001935.2-949s1c1
Sequence:CCGGCCAATGCAACTTCCATACAAACTCGAGTTTGTATGGAAGTTGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001935.2-271s1c1
Sequence:CCGGGACTGAAGTTATACTCCTTAACTCGAGTTAAGGAGTATAACTTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001935.2-809s1c1
Sequence:CCGGCCCACTTATTGAATACTCCTTCTCGAGAAGGAGTATTCAATAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001935
DPP4 MISSION shRNA shRNA Plasmid DNA
dipeptidyl-peptidase 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001935.3-1943s21c1
Sequence:CCGGTCAGTAAAGAGGCGAAGTATTCTCGAGAATACTTCGCCTCTTTACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001935.3-689s21c1
Sequence:CCGGACACTCTAACTGATTACTTAACTCGAGTTAAGTAATCAGTTAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001935.3-1031s21c1
Sequence:CCGGGGTCACCAGTGGGTCATAAATCTCGAGATTTATGACCCACTGGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001935.2-786s1c1
Sequence:CCGGGCCCAATTTAACGACACAGAACTCGAGTTCTGTGTCGTTAAATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001935.2-2136s1c1
Sequence:CCGGCCAGAAGACAACCTTGACCATCTCGAGATGGTCAAGGTTGTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001935.2-949s1c1
Sequence:CCGGCCAATGCAACTTCCATACAAACTCGAGTTTGTATGGAAGTTGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001935.2-271s1c1
Sequence:CCGGGACTGAAGTTATACTCCTTAACTCGAGTTAAGGAGTATAACTTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001935.2-809s1c1
Sequence:CCGGCCCACTTATTGAATACTCCTTCTCGAGAAGGAGTATTCAATAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001935
DPP4 MISSION shRNA Lentiviral Transduction Particles
dipeptidyl-peptidase 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001935.3-1943s21c1
Sequence:CCGGTCAGTAAAGAGGCGAAGTATTCTCGAGAATACTTCGCCTCTTTACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001935.3-689s21c1
Sequence:CCGGACACTCTAACTGATTACTTAACTCGAGTTAAGTAATCAGTTAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001935.3-1031s21c1
Sequence:CCGGGGTCACCAGTGGGTCATAAATCTCGAGATTTATGACCCACTGGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001935.2-786s1c1
Sequence:CCGGGCCCAATTTAACGACACAGAACTCGAGTTCTGTGTCGTTAAATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001935.2-2136s1c1
Sequence:CCGGCCAGAAGACAACCTTGACCATCTCGAGATGGTCAAGGTTGTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001935.2-949s1c1
Sequence:CCGGCCAATGCAACTTCCATACAAACTCGAGTTTGTATGGAAGTTGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001935.2-271s1c1
Sequence:CCGGGACTGAAGTTATACTCCTTAACTCGAGTTAAGGAGTATAACTTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001935.2-809s1c1
Sequence:CCGGCCCACTTATTGAATACTCCTTCTCGAGAAGGAGTATTCAATAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks