EMAIL THIS PAGE TO A FRIEND

DPP6

dipeptidyl-peptidase 6

154 Gene Product Result for
Synonyms: DPPX VF2
UniProtKB ID: P42658
Gene ID:
Human(1804) Summary: This gene encodes a single-pass type II membrane protein that is a member of the S9B family in clan SC of the serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(13483) dipeptidylpeptidase 6
Rat(29272) dipeptidylpeptidase 6
chicken(420440) dipeptidyl-peptidase 6
dog(475553) dipeptidyl-peptidase 6
cow(281123) dipeptidyl-peptidase 6
domestic cat(101084350) dipeptidyl-peptidase 6
sheep(101105907) dipeptidyl-peptidase 6
naked mole-rat(101724848) dipeptidyl-peptidase 6
domestic guinea pig(100724568) dipeptidyl-peptidase 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100621 Anti-DPP6 (ab1) antibody produced in rabbit affinity isolated antibody rat, guinea pig, human, horse, zebrafish, mouse, rabbit, bovine
western blot pricing
SAB2100622 Anti-DPP6 (ab2) antibody produced in rabbit affinity isolated antibody mouse, human, rabbit, rat, guinea pig, horse, bovine
western blot pricing
HPA050509 Anti-DPP6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse
immunohistochemistry, western blot pricing
SAB2900648 Anti-DPP6 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130797 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130797 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130797 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010075 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010075 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010075 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039350 Rosetta Predictions human pricing
NM_001936 Rosetta Predictions human pricing
NM_130797 Rosetta Predictions human pricing
NM_022850 Rosetta Predictions rat pricing
NM_010075 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039350 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118706 predicted 2599
2 SASI_Hs01_00118708 predicted 1208
3 SASI_Hs01_00118709 predicted 2433
4 SASI_Hs01_00118710 predicted 2440
5 SASI_Hs02_00308461 predicted 1876
6 SASI_Hs01_00118711 predicted 1471
7 SASI_Hs01_00118712 predicted 861
8 SASI_Hs01_00118713 predicted 2588
9 SASI_Hs01_00118714 predicted 1207
10 SASI_Hs01_00118715 predicted 2343
11 SASI_Hs01_00118707 predicted 1880
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001936 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118986 predicted 2490
2 SASI_Hs01_00118988 predicted 1098
3 SASI_Hs01_00118989 predicted 2321
4 SASI_Hs01_00118990 predicted 2326
5 SASI_Hs02_00332838 predicted 1760
6 SASI_Hs01_00118991 predicted 1364
7 SASI_Hs01_00118992 predicted 750
8 SASI_Hs01_00118993 predicted 2473
9 SASI_Hs01_00118994 predicted 1095
10 SASI_Hs01_00118995 predicted 2228
11 SASI_Hs01_00118987 predicted 1775
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130797 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147572 predicted 2577
2 SASI_Hs01_00147574 predicted 1177
3 SASI_Hs01_00147575 predicted 2409
4 SASI_Hs02_00362827 predicted 2410
5 SASI_Hs01_00147576 predicted 1443
6 SASI_Hs02_00362828 predicted 825
7 SASI_Hs01_00147577 predicted 2558
8 SASI_Hs02_00362829 predicted 1181
9 SASI_Hs01_00147578 predicted 2310
10 SASI_Hs01_00147579 predicted 2589
11 SASI_Hs01_00147573 predicted 640
12 SASI_Hs01_00147580 predicted 1118
13 SASI_Hs01_00147581 predicted 716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022850 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041507 predicted 632
2 SASI_Rn01_00041508 predicted 2591
3 SASI_Rn01_00041509 predicted 961
4 SASI_Rn01_00041510 predicted 2308
5 SASI_Rn02_00263565 predicted 2298
6 SASI_Rn01_00041511 predicted 2175
7 SASI_Rn01_00041513 predicted 1866
8 SASI_Rn01_00041514 predicted 1855
9 SASI_Rn01_00041515 predicted 1669
10 SASI_Rn01_00041516 predicted 2365
11 SASI_Rn01_00041512 predicted 1811
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010075 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058083 predicted 1312
2 SASI_Mm01_00058084 predicted 2155
3 SASI_Mm01_00058085 predicted 1993
4 SASI_Mm01_00058087 predicted 966
5 SASI_Mm01_00058088 predicted 1727
6 SASI_Mm01_00058090 predicted 2295
7 SASI_Mm01_00058091 predicted 1333
8 SASI_Mm01_00058092 predicted 973
9 SASI_Mm02_00317756 predicted 2953
10 SASI_Mm02_00317757 predicted 884
11 SASI_Mm01_00058086 predicted 1126
12 SASI_Mm01_00058089 predicted 2651
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130797
DPP6 MISSION shRNA Bacterial Glycerol Stock
dipeptidyl-peptidase 6
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130797.1-1884s1c1
Sequence:CCGGCATGTCAAGAAGGCCATAAATCTCGAGATTTATGGCCTTCTTGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130797.1-1207s1c1
Sequence:CCGGCCCTACACGTTATTGGCTTAACTCGAGTTAAGCCAATAACGTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130797.1-768s1c1
Sequence:CCGGCCCATATATCAACACTCGTATCTCGAGATACGAGTGTTGATATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130797.1-2544s1c1
Sequence:CCGGGCAGAACTCATTACACAACTACTCGAGTAGTTGTGTAATGAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130797.1-2601s1c1
Sequence:CCGGCCGGACGAAAGCCATTACTTTCTCGAGAAAGTAATGGCTTTCGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130797.2-3191s21c1
Sequence:CCGGTAGCAGTGCGTGTTCATATATCTCGAGATATATGAACACGCACTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130797
DPP6 MISSION shRNA shRNA Plasmid DNA
dipeptidyl-peptidase 6
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130797.1-1884s1c1
Sequence:CCGGCATGTCAAGAAGGCCATAAATCTCGAGATTTATGGCCTTCTTGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130797.1-1207s1c1
Sequence:CCGGCCCTACACGTTATTGGCTTAACTCGAGTTAAGCCAATAACGTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130797.1-768s1c1
Sequence:CCGGCCCATATATCAACACTCGTATCTCGAGATACGAGTGTTGATATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130797.1-2544s1c1
Sequence:CCGGGCAGAACTCATTACACAACTACTCGAGTAGTTGTGTAATGAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130797.1-2601s1c1
Sequence:CCGGCCGGACGAAAGCCATTACTTTCTCGAGAAAGTAATGGCTTTCGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130797.2-3191s21c1
Sequence:CCGGTAGCAGTGCGTGTTCATATATCTCGAGATATATGAACACGCACTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130797
DPP6 MISSION shRNA Lentiviral Transduction Particles
dipeptidyl-peptidase 6
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130797.1-1884s1c1
Sequence:CCGGCATGTCAAGAAGGCCATAAATCTCGAGATTTATGGCCTTCTTGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130797.1-1207s1c1
Sequence:CCGGCCCTACACGTTATTGGCTTAACTCGAGTTAAGCCAATAACGTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130797.1-768s1c1
Sequence:CCGGCCCATATATCAACACTCGTATCTCGAGATACGAGTGTTGATATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130797.1-2544s1c1
Sequence:CCGGGCAGAACTCATTACACAACTACTCGAGTAGTTGTGTAATGAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130797.1-2601s1c1
Sequence:CCGGCCGGACGAAAGCCATTACTTTCTCGAGAAAGTAATGGCTTTCGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130797.2-3191s21c1
Sequence:CCGGTAGCAGTGCGTGTTCATATATCTCGAGATATATGAACACGCACTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010075
DPP6 MISSION shRNA Bacterial Glycerol Stock
dipeptidyl-peptidase 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010075.1-2984s1c1
Sequence:CCGGCCCAGATGAGAGTCACTACTTCTCGAGAAGTAGTGACTCTCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010075.1-1593s1c1
Sequence:CCGGCTCCATGTCATCGGCTTGAATCTCGAGATTCAAGCCGATGACATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010075.1-1138s1c1
Sequence:CCGGCCTATAATGTGGAGCCGGTATCTCGAGATACCGGCTCCACATTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010075.1-1028s1c1
Sequence:CCGGGCGGAATGTTGAAACAAATAACTCGAGTTATTTGTTTCAACATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010075.1-2147s1c1
Sequence:CCGGCGCTTCTTTCAGCCATAACATCTCGAGATGTTATGGCTGAAAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010075
DPP6 MISSION shRNA shRNA Plasmid DNA
dipeptidyl-peptidase 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010075.1-2984s1c1
Sequence:CCGGCCCAGATGAGAGTCACTACTTCTCGAGAAGTAGTGACTCTCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010075.1-1593s1c1
Sequence:CCGGCTCCATGTCATCGGCTTGAATCTCGAGATTCAAGCCGATGACATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010075.1-1138s1c1
Sequence:CCGGCCTATAATGTGGAGCCGGTATCTCGAGATACCGGCTCCACATTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010075.1-1028s1c1
Sequence:CCGGGCGGAATGTTGAAACAAATAACTCGAGTTATTTGTTTCAACATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010075.1-2147s1c1
Sequence:CCGGCGCTTCTTTCAGCCATAACATCTCGAGATGTTATGGCTGAAAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010075
DPP6 MISSION shRNA Lentiviral Transduction Particles
dipeptidyl-peptidase 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010075.1-2984s1c1
Sequence:CCGGCCCAGATGAGAGTCACTACTTCTCGAGAAGTAGTGACTCTCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010075.1-1593s1c1
Sequence:CCGGCTCCATGTCATCGGCTTGAATCTCGAGATTCAAGCCGATGACATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010075.1-1138s1c1
Sequence:CCGGCCTATAATGTGGAGCCGGTATCTCGAGATACCGGCTCCACATTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010075.1-1028s1c1
Sequence:CCGGGCGGAATGTTGAAACAAATAACTCGAGTTATTTGTTTCAACATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010075.1-2147s1c1
Sequence:CCGGCGCTTCTTTCAGCCATAACATCTCGAGATGTTATGGCTGAAAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks