EMAIL THIS PAGE TO A FRIEND

DPP7

dipeptidyl-peptidase 7

56 Gene Product Result for
Synonyms: DPP2 DPPII QPP
UniProtKB ID: Q9UHL4, A8K7U7, Q5VSF1, Q969X4
Gene ID:
Human(29952) Summary: The protein encoded by this gene is a post-proline cleaving aminopeptidase expressed in quiescent lymphocytes. The resting lymphocytes are maintained through suppression of apoptosis, a state which is disrupted by inhibition of this novel serine protease. The enzyme has strong sequence homology with prolylcarboxypeptidase and is active at both acidic and neutral pH. [provided by RefSeq, Jul 2008]
Mouse(83768) dipeptidylpeptidase 7
Rat(83799) dipeptidylpeptidase 7
Zebrafish(503737) dipeptidyl-peptidase 7
chicken(417297) dipeptidyl-peptidase 7
domestic cat(101095966) dipeptidyl-peptidase 7
cow(100125760) dipeptidyl-peptidase 7
dog(607003) dipeptidyl-peptidase 7
domestic guinea pig(100716276) dipeptidyl-peptidase 7
naked mole-rat(101724543) dipeptidyl-peptidase 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1418 Human DPPII ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013379 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013379 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013379 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031843 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031843 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031843 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013379 Rosetta Predictions human pricing
NM_031973 Rosetta Predictions rat pricing
NM_031843 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013379 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165973 predicted 267
2 SASI_Hs01_00165975 predicted 1111
3 SASI_Hs02_00344729 predicted 1106
4 SASI_Hs01_00165977 predicted 524
5 SASI_Hs01_00165978 predicted 903
6 SASI_Hs01_00165979 predicted 1106
7 SASI_Hs02_00344730 predicted 905
8 SASI_Hs01_00165980 predicted 986
9 SASI_Hs01_00165981 predicted 346
10 SASI_Hs02_00344731 predicted 1119
11 SASI_Hs01_00165974 predicted 1101
12 SASI_Hs01_00165976 predicted 1304
13 SASI_Hs01_00165982 predicted 1243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031973 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031646 predicted 292
2 SASI_Rn01_00031647 predicted 758
3 SASI_Rn02_00265362 predicted 310
4 SASI_Rn02_00265363 predicted 1158
5 SASI_Rn01_00031648 predicted 363
6 SASI_Rn01_00031650 predicted 849
7 SASI_Rn01_00031651 predicted 936
8 SASI_Rn01_00031652 predicted 1193
9 SASI_Rn02_00265364 predicted 915
10 SASI_Rn01_00031654 predicted 565
11 SASI_Rn01_00031649 predicted 838
12 SASI_Rn01_00031653 predicted 1266
13 SASI_Rn01_00031655 predicted 731
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031843 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166194 predicted 755
2 SASI_Mm01_00166195 predicted 827
3 SASI_Mm01_00166196 predicted 1162
4 SASI_Mm01_00166197 predicted 353
5 SASI_Mm01_00166198 predicted 905
6 SASI_Mm01_00166199 predicted 734
7 SASI_Mm01_00166200 predicted 995
8 SASI_Mm01_00166201 predicted 1368
9 SASI_Mm02_00337178 predicted 1149
10 SASI_Mm01_00166202 predicted 267
11 SASI_Mm01_00166203 predicted 647
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013379
DPP7 MISSION shRNA Bacterial Glycerol Stock
dipeptidyl-peptidase 7
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013379.2-656s21c1
Sequence:CCGGTTGAGGGCCAGAGTCCCAAATCTCGAGATTTGGGACTCTGGCCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013379.2-1432s21c1
Sequence:CCGGATCATCGGCGAGTGGGTAAAGCTCGAGCTTTACCCACTCGCCGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013379.2-499s21c1
Sequence:CCGGATCGCCTTCGGTGGAAGTTATCTCGAGATAACTTCCACCGAAGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013379.1-1079s1c1
Sequence:CCGGCCAGCAACAATGTGACCGATACTCGAGTATCGGTCACATTGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013379.1-672s1c1
Sequence:CCGGCCGACAGATCAAGGACTTGTTCTCGAGAACAAGTCCTTGATCTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013379.1-210s1c1
Sequence:CCGGCACCTTCTTCTACACTGGGAACTCGAGTTCCCAGTGTAGAAGAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013379.1-505s1c1
Sequence:CCGGGCCTACCTGAGGATGAAGTATCTCGAGATACTTCATCCTCAGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013379.1-957s1c1
Sequence:CCGGCGAGCACTGCTACGACATCTACTCGAGTAGATGTCGTAGCAGTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013379
DPP7 MISSION shRNA shRNA Plasmid DNA
dipeptidyl-peptidase 7
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013379.2-656s21c1
Sequence:CCGGTTGAGGGCCAGAGTCCCAAATCTCGAGATTTGGGACTCTGGCCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013379.2-1432s21c1
Sequence:CCGGATCATCGGCGAGTGGGTAAAGCTCGAGCTTTACCCACTCGCCGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013379.2-499s21c1
Sequence:CCGGATCGCCTTCGGTGGAAGTTATCTCGAGATAACTTCCACCGAAGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013379.1-1079s1c1
Sequence:CCGGCCAGCAACAATGTGACCGATACTCGAGTATCGGTCACATTGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013379.1-672s1c1
Sequence:CCGGCCGACAGATCAAGGACTTGTTCTCGAGAACAAGTCCTTGATCTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013379.1-210s1c1
Sequence:CCGGCACCTTCTTCTACACTGGGAACTCGAGTTCCCAGTGTAGAAGAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013379.1-505s1c1
Sequence:CCGGGCCTACCTGAGGATGAAGTATCTCGAGATACTTCATCCTCAGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013379.1-957s1c1
Sequence:CCGGCGAGCACTGCTACGACATCTACTCGAGTAGATGTCGTAGCAGTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013379
DPP7 MISSION shRNA Lentiviral Transduction Particles
dipeptidyl-peptidase 7
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013379.2-656s21c1
Sequence:CCGGTTGAGGGCCAGAGTCCCAAATCTCGAGATTTGGGACTCTGGCCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013379.2-1432s21c1
Sequence:CCGGATCATCGGCGAGTGGGTAAAGCTCGAGCTTTACCCACTCGCCGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013379.2-499s21c1
Sequence:CCGGATCGCCTTCGGTGGAAGTTATCTCGAGATAACTTCCACCGAAGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013379.1-1079s1c1
Sequence:CCGGCCAGCAACAATGTGACCGATACTCGAGTATCGGTCACATTGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013379.1-672s1c1
Sequence:CCGGCCGACAGATCAAGGACTTGTTCTCGAGAACAAGTCCTTGATCTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013379.1-210s1c1
Sequence:CCGGCACCTTCTTCTACACTGGGAACTCGAGTTCCCAGTGTAGAAGAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013379.1-505s1c1
Sequence:CCGGGCCTACCTGAGGATGAAGTATCTCGAGATACTTCATCCTCAGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013379.1-957s1c1
Sequence:CCGGCGAGCACTGCTACGACATCTACTCGAGTAGATGTCGTAGCAGTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031843
VALIDATED
DPP7 MISSION shRNA Bacterial Glycerol Stock
dipeptidyl-peptidase 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031843.2-158s21c1
Sequence:CCGGCCATTTCAACTTTGAGAGTTTCTCGAGAAACTCTCAAAGTTGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031843.2-200s21c1
Sequence:CCGGGCGGTTCCTAGTGTCAGATAACTCGAGTTATCTGACACTAGGAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031843.2-1001s21c1
Sequence:CCGGTTATGACATCTACCGGTTATACTCGAGTATAACCGGTAGATGTCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031843.2-120s21c1
Sequence:CCGGCCTGACTTTCATGAGAATTATCTCGAGATAATTCTCATGAAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031843.2-1462s21c1
Sequence:CCGGCCAGACTAAAGCAACCAGCAACTCGAGTTGCTGGTTGCTTTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031843.2-158s1c1
Sequence:CCGGCCATTTCAACTTTGAGAGTTTCTCGAGAAACTCTCAAAGTTGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031843.2-1462s1c1
Sequence:CCGGCCAGACTAAAGCAACCAGCAACTCGAGTTGCTGGTTGCTTTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031843.2-120s1c1
Sequence:CCGGCCTGACTTTCATGAGAATTATCTCGAGATAATTCTCATGAAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031843.2-1534s1c1
Sequence:CCGGCAAACCCCAGACATCCCTTGTCTCGAGACAAGGGATGTCTGGGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031843.2-1168s1c1
Sequence:CCGGGCCAGCAATACTGTCTGGATACTCGAGTATCCAGACAGTATTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031843
VALIDATED
DPP7 MISSION shRNA shRNA Plasmid DNA
dipeptidyl-peptidase 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031843.2-158s21c1
Sequence:CCGGCCATTTCAACTTTGAGAGTTTCTCGAGAAACTCTCAAAGTTGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031843.2-200s21c1
Sequence:CCGGGCGGTTCCTAGTGTCAGATAACTCGAGTTATCTGACACTAGGAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031843.2-1001s21c1
Sequence:CCGGTTATGACATCTACCGGTTATACTCGAGTATAACCGGTAGATGTCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031843.2-120s21c1
Sequence:CCGGCCTGACTTTCATGAGAATTATCTCGAGATAATTCTCATGAAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031843.2-1462s21c1
Sequence:CCGGCCAGACTAAAGCAACCAGCAACTCGAGTTGCTGGTTGCTTTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031843.2-158s1c1
Sequence:CCGGCCATTTCAACTTTGAGAGTTTCTCGAGAAACTCTCAAAGTTGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031843.2-1462s1c1
Sequence:CCGGCCAGACTAAAGCAACCAGCAACTCGAGTTGCTGGTTGCTTTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031843.2-120s1c1
Sequence:CCGGCCTGACTTTCATGAGAATTATCTCGAGATAATTCTCATGAAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031843.2-1534s1c1
Sequence:CCGGCAAACCCCAGACATCCCTTGTCTCGAGACAAGGGATGTCTGGGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031843.2-1168s1c1
Sequence:CCGGGCCAGCAATACTGTCTGGATACTCGAGTATCCAGACAGTATTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031843
VALIDATED
DPP7 MISSION shRNA Lentiviral Transduction Particles
dipeptidyl-peptidase 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031843.2-158s21c1
Sequence:CCGGCCATTTCAACTTTGAGAGTTTCTCGAGAAACTCTCAAAGTTGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031843.2-200s21c1
Sequence:CCGGGCGGTTCCTAGTGTCAGATAACTCGAGTTATCTGACACTAGGAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031843.2-1001s21c1
Sequence:CCGGTTATGACATCTACCGGTTATACTCGAGTATAACCGGTAGATGTCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031843.2-120s21c1
Sequence:CCGGCCTGACTTTCATGAGAATTATCTCGAGATAATTCTCATGAAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031843.2-1462s21c1
Sequence:CCGGCCAGACTAAAGCAACCAGCAACTCGAGTTGCTGGTTGCTTTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031843.2-158s1c1
Sequence:CCGGCCATTTCAACTTTGAGAGTTTCTCGAGAAACTCTCAAAGTTGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031843.2-1462s1c1
Sequence:CCGGCCAGACTAAAGCAACCAGCAACTCGAGTTGCTGGTTGCTTTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031843.2-120s1c1
Sequence:CCGGCCTGACTTTCATGAGAATTATCTCGAGATAATTCTCATGAAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031843.2-1534s1c1
Sequence:CCGGCAAACCCCAGACATCCCTTGTCTCGAGACAAGGGATGTCTGGGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031843.2-1168s1c1
Sequence:CCGGGCCAGCAATACTGTCTGGATACTCGAGTATCCAGACAGTATTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks