EMAIL THIS PAGE TO A FRIEND

DPP8

dipeptidyl-peptidase 8

146 Gene Product Result for
Synonyms: DP8 DPRP1 MSTP141
Gene ID:
Human(54878) Summary: This gene encodes a member of the peptidase S9B family, a small family of dipeptidyl peptidases that are able to cleave peptide substrates at a prolyl bond. The encoded protein shares similarity with dipeptidyl peptidase IV in that it is ubiquitously expressed, and hydrolyzes the same substrates. These similarities suggest that, like dipeptidyl peptidase IV, this protein may play a role in T-cell activation and immune function. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(74388) dipeptidylpeptidase 8
Rat(315758) dipeptidylpeptidase 8
sheep(101119728) dipeptidyl-peptidase 8
Domestic Rabbit(100346226) dipeptidyl-peptidase 8
naked mole-rat(101720923) dipeptidyl-peptidase 8
domestic guinea pig(100720764) dipeptidyl-peptidase 8
chicken(427512) dipeptidyl-peptidase 8
cow(536604) dipeptidyl-peptidase 8
Horse(100053245) dipeptidyl-peptidase 8
dog(487605) dipeptidyl-peptidase 8
domestic cat(101084543) dipeptidyl-peptidase 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028906 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028906 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028906 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017743 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017743 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017743 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017743 Rosetta Predictions human pricing
NM_130434 Rosetta Predictions human pricing
NM_197960 Rosetta Predictions human pricing
NM_197961 Rosetta Predictions human pricing
NM_001108159 Rosetta Predictions rat pricing
NM_028906 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017743 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179985 predicted 1014
2 SASI_Hs01_00179986 predicted 1771
3 SASI_Hs01_00179987 predicted 540
4 SASI_Hs01_00179988 predicted 601
5 SASI_Hs01_00179989 predicted 1749
6 SASI_Hs02_00350545 predicted 761
7 SASI_Hs01_00179991 predicted 725
8 SASI_Hs01_00179992 predicted 993
9 SASI_Hs01_00179994 predicted 1375
10 SASI_Hs02_00350546 predicted 1232
11 SASI_Hs01_00179990 predicted 558
12 SASI_Hs01_00179993 predicted 2486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130434 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234528 predicted 1017
2 SASI_Hs01_00234529 predicted 1765
3 SASI_Hs01_00234530 predicted 535
4 SASI_Hs01_00234531 predicted 606
5 SASI_Hs01_00234532 predicted 1746
6 SASI_Hs02_00362728 predicted 760
7 SASI_Hs01_00234534 predicted 724
8 SASI_Hs01_00234535 predicted 992
9 SASI_Hs01_00234537 predicted 1376
10 SASI_Hs02_00362729 predicted 1232
11 SASI_Hs01_00234533 predicted 551
12 SASI_Hs01_00234536 predicted 2786
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197960 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045259 predicted 1003
2 SASI_Hs01_00045260 predicted 1762
3 SASI_Hs01_00045261 predicted 529
4 SASI_Hs01_00045262 predicted 596
5 SASI_Hs01_00045263 predicted 1741
6 SASI_Hs02_00371563 predicted 742
7 SASI_Hs01_00045265 predicted 706
8 SASI_Hs01_00045266 predicted 976
9 SASI_Hs01_00045268 predicted 1360
10 SASI_Hs02_00371564 predicted 1226
11 SASI_Hs01_00045264 predicted 549
12 SASI_Hs01_00045267 predicted 2771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197961 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099942 predicted 1152
2 SASI_Hs01_00099943 predicted 1907
3 SASI_Hs01_00099944 predicted 670
4 SASI_Hs01_00099945 predicted 737
5 SASI_Hs01_00099946 predicted 1886
6 SASI_Hs02_00371565 predicted 895
7 SASI_Hs01_00099948 predicted 857
8 SASI_Hs01_00099949 predicted 1123
9 SASI_Hs01_00099951 predicted 1508
10 SASI_Hs02_00371566 predicted 1371
11 SASI_Hs01_00099947 predicted 694
12 SASI_Hs01_00099950 predicted 2771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108159 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235934 predicted 1326
2 SASI_Rn02_00235935 predicted 920
3 SASI_Rn02_00235936 predicted 1898
4 SASI_Rn02_00235937 predicted 2203
5 SASI_Rn02_00235938 predicted 1681
6 SASI_Rn02_00235939 predicted 1526
7 SASI_Rn02_00235940 predicted 1818
8 SASI_Rn02_00235941 predicted 676
9 SASI_Rn02_00235942 predicted 2312
10 SASI_Rn02_00235943 predicted 1339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028906 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112274 predicted 1328
2 SASI_Mm01_00112275 predicted 2718
3 SASI_Mm01_00112276 predicted 887
4 SASI_Mm01_00112277 predicted 1867
5 SASI_Mm01_00112278 predicted 2964
6 SASI_Mm02_00334590 predicted 1284
7 SASI_Mm01_00112279 predicted 2635
8 SASI_Mm01_00112280 predicted 2819
9 SASI_Mm01_00112281 predicted 2301
10 SASI_Mm01_00112282 predicted 1598
11 SASI_Mm01_00112283 predicted 2470
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028906
VALIDATED
DPP8 MISSION shRNA Bacterial Glycerol Stock
dipeptidyl-peptidase 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028906.2-504s1c1
Sequence:CCGGGCGCCACATGACTTTATGTTTCTCGAGAAACATAAAGTCATGTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028906.2-1869s1c1
Sequence:CCGGGCCAGAAAGCTGGTGTACTTTCTCGAGAAAGTACACCAGCTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028906.2-942s1c1
Sequence:CCGGCCAGACTGGATAGCTTTCATTCTCGAGAATGAAAGCTATCCAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028906.2-2294s1c1
Sequence:CCGGGCTGGTGAACAATCGGTTTAACTCGAGTTAAACCGATTGTTCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028906.2-2945s1c1
Sequence:CCGGCGCTGCTCTGAAAGTGATATACTCGAGTATATCACTTTCAGAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028906
VALIDATED
DPP8 MISSION shRNA shRNA Plasmid DNA
dipeptidyl-peptidase 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028906.2-504s1c1
Sequence:CCGGGCGCCACATGACTTTATGTTTCTCGAGAAACATAAAGTCATGTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028906.2-1869s1c1
Sequence:CCGGGCCAGAAAGCTGGTGTACTTTCTCGAGAAAGTACACCAGCTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028906.2-942s1c1
Sequence:CCGGCCAGACTGGATAGCTTTCATTCTCGAGAATGAAAGCTATCCAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028906.2-2294s1c1
Sequence:CCGGGCTGGTGAACAATCGGTTTAACTCGAGTTAAACCGATTGTTCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028906.2-2945s1c1
Sequence:CCGGCGCTGCTCTGAAAGTGATATACTCGAGTATATCACTTTCAGAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028906
VALIDATED
DPP8 MISSION shRNA Lentiviral Transduction Particles
dipeptidyl-peptidase 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028906.2-504s1c1
Sequence:CCGGGCGCCACATGACTTTATGTTTCTCGAGAAACATAAAGTCATGTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028906.2-1869s1c1
Sequence:CCGGGCCAGAAAGCTGGTGTACTTTCTCGAGAAAGTACACCAGCTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028906.2-942s1c1
Sequence:CCGGCCAGACTGGATAGCTTTCATTCTCGAGAATGAAAGCTATCCAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028906.2-2294s1c1
Sequence:CCGGGCTGGTGAACAATCGGTTTAACTCGAGTTAAACCGATTGTTCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028906.2-2945s1c1
Sequence:CCGGCGCTGCTCTGAAAGTGATATACTCGAGTATATCACTTTCAGAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017743
VALIDATED
DPP8 MISSION shRNA Bacterial Glycerol Stock
dipeptidyl-peptidase 8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017743.3-674s1c1
Sequence:CCGGCGGAATTGCTTCTTACGATTACTCGAGTAATCGTAAGAAGCAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017743.3-2280s1c1
Sequence:CCGGGACCAGAATGAACAGGGCTATCTCGAGATAGCCCTGTTCATTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017743.3-417s1c1
Sequence:CCGGGCACCACATGATTTCATGTTTCTCGAGAAACATGAAATCATGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075258    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017743.3-2586s1c1
Sequence:CCGGCCTGTGTAGAACTCTCTGGTACTCGAGTACCAGAGAGTTCTACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017743.3-1676s1c1
Sequence:CCGGGCCTGCTCCAAGTGATTTCAACTCGAGTTGAAATCACTTGGAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017743.4-2242s21c1
Sequence:CCGGAGGATACACGGAACGTTATATCTCGAGATATAACGTTCCGTGTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017743.4-667s21c1
Sequence:CCGGCGGAATTGCTTCTTACGATTACTCGAGTAATCGTAAGAAGCAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017743.4-1669s21c1
Sequence:CCGGGCCTGCTCCAAGTGATTTCAACTCGAGTTGAAATCACTTGGAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017743.4-2722s21c1
Sequence:CCGGTCTACGGTTTGTGGTAGTAATCTCGAGATTACTACCACAAACCGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017743.4-410s21c1
Sequence:CCGGGCACCACATGATTTCATGTTTCTCGAGAAACATGAAATCATGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017743
VALIDATED
DPP8 MISSION shRNA shRNA Plasmid DNA
dipeptidyl-peptidase 8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017743.3-674s1c1
Sequence:CCGGCGGAATTGCTTCTTACGATTACTCGAGTAATCGTAAGAAGCAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017743.3-2280s1c1
Sequence:CCGGGACCAGAATGAACAGGGCTATCTCGAGATAGCCCTGTTCATTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017743.3-417s1c1
Sequence:CCGGGCACCACATGATTTCATGTTTCTCGAGAAACATGAAATCATGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075258    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017743.3-2586s1c1
Sequence:CCGGCCTGTGTAGAACTCTCTGGTACTCGAGTACCAGAGAGTTCTACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017743.3-1676s1c1
Sequence:CCGGGCCTGCTCCAAGTGATTTCAACTCGAGTTGAAATCACTTGGAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017743.4-2242s21c1
Sequence:CCGGAGGATACACGGAACGTTATATCTCGAGATATAACGTTCCGTGTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017743.4-667s21c1
Sequence:CCGGCGGAATTGCTTCTTACGATTACTCGAGTAATCGTAAGAAGCAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017743.4-1669s21c1
Sequence:CCGGGCCTGCTCCAAGTGATTTCAACTCGAGTTGAAATCACTTGGAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017743.4-2722s21c1
Sequence:CCGGTCTACGGTTTGTGGTAGTAATCTCGAGATTACTACCACAAACCGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017743.4-410s21c1
Sequence:CCGGGCACCACATGATTTCATGTTTCTCGAGAAACATGAAATCATGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017743
VALIDATED
DPP8 MISSION shRNA Lentiviral Transduction Particles
dipeptidyl-peptidase 8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017743.3-674s1c1
Sequence:CCGGCGGAATTGCTTCTTACGATTACTCGAGTAATCGTAAGAAGCAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017743.3-2280s1c1
Sequence:CCGGGACCAGAATGAACAGGGCTATCTCGAGATAGCCCTGTTCATTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017743.3-417s1c1
Sequence:CCGGGCACCACATGATTTCATGTTTCTCGAGAAACATGAAATCATGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075258    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017743.3-2586s1c1
Sequence:CCGGCCTGTGTAGAACTCTCTGGTACTCGAGTACCAGAGAGTTCTACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017743.3-1676s1c1
Sequence:CCGGGCCTGCTCCAAGTGATTTCAACTCGAGTTGAAATCACTTGGAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017743.4-2242s21c1
Sequence:CCGGAGGATACACGGAACGTTATATCTCGAGATATAACGTTCCGTGTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017743.4-667s21c1
Sequence:CCGGCGGAATTGCTTCTTACGATTACTCGAGTAATCGTAAGAAGCAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017743.4-1669s21c1
Sequence:CCGGGCCTGCTCCAAGTGATTTCAACTCGAGTTGAAATCACTTGGAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017743.4-2722s21c1
Sequence:CCGGTCTACGGTTTGTGGTAGTAATCTCGAGATTACTACCACAAACCGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017743.4-410s21c1
Sequence:CCGGGCACCACATGATTTCATGTTTCTCGAGAAACATGAAATCATGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks