EMAIL THIS PAGE TO A FRIEND

DPP9

dipeptidyl-peptidase 9

72 Gene Product Result for
Synonyms: DP9 DPLP9 DPRP-2 DPRP2
Gene ID:
Human(91039) Summary: This gene encodes a protein that is a member of the S9B family in clan SC of the serine proteases. The protein has been shown to have post-proline dipeptidyl aminopeptidase activity, cleaving Xaa-Pro dipeptides from the N-termini of proteins. Although the activity of this protein is similar to that of dipeptidyl peptidase 4 (DPP4), it does not appear to be membrane bound. In general, dipeptidyl peptidases appear to be involved in the regulation of the activity of their substrates and have been linked to a variety of diseases including type 2 diabetes, obesity and cancer. Several transcript variants of this gene have been described but not fully characterized. [provided by RefSeq, Jul 2008]
Mouse(224897) dipeptidylpeptidase 9
Rat(301130) dipeptidyl peptidase 9
Zebrafish(768170) dipeptidyl-peptidase 9
chicken(420159) dipeptidyl-peptidase 9
cow(521100) dipeptidyl-peptidase 9
Horse(100062517) dipeptidyl-peptidase 9
domestic cat(101091347) dipeptidyl-peptidase 9
dog(485033) dipeptidyl-peptidase 9
domestic guinea pig(100720281) dipeptidyl-peptidase 9
naked mole-rat(101722408) dipeptidyl-peptidase 9
sheep(101113589) dipeptidyl-peptidase 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139159 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139159 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139159 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172624 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172624 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172624 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139159 Rosetta Predictions human pricing
XM_001061312 Rosetta Predictions rat pricing
XM_217309 Rosetta Predictions rat pricing
NM_172624 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139159 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098416 predicted 482
2 SASI_Hs01_00098417 predicted 1615
3 SASI_Hs01_00098418 predicted 2631
4 SASI_Hs01_00098419 predicted 861
5 SASI_Hs01_00098420 predicted 571
6 SASI_Hs01_00098422 predicted 1908
7 SASI_Hs01_00098423 predicted 2706
8 SASI_Hs01_00098424 predicted 1568
9 SASI_Hs01_00098425 predicted 588
10 SASI_Hs02_00364167 predicted 1347
11 SASI_Hs01_00098421 predicted 2129
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061312 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00299593 predicted 950
2 SASI_Rn02_00299594 predicted 502
3 SASI_Rn02_00299595 predicted 1922
4 SASI_Rn02_00299596 predicted 2168
5 SASI_Rn02_00299597 predicted 759
6 SASI_Rn02_00299598 predicted 763
7 SASI_Rn02_00299599 predicted 2764
8 SASI_Rn02_00299600 predicted 1262
9 SASI_Rn02_00299601 predicted 487
10 SASI_Rn02_00299602 predicted 1912
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217309 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377120 predicted 949
2 SASI_Rn02_00377121 predicted 505
3 SASI_Rn02_00377122 predicted 1925
4 SASI_Rn02_00377123 predicted 2169
5 SASI_Rn02_00377124 predicted 757
6 SASI_Rn02_00377125 predicted 761
7 SASI_Rn02_00377126 predicted 2767
8 SASI_Rn02_00377127 predicted 1265
9 SASI_Rn02_00377128 predicted 495
10 SASI_Rn02_00377129 predicted 1915
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172624 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053072 predicted 1018
2 SASI_Mm01_00053073 predicted 1434
3 SASI_Mm01_00053074 predicted 2673
4 SASI_Mm01_00053075 predicted 2656
5 SASI_Mm01_00053076 predicted 703
6 SASI_Mm01_00053077 predicted 380
7 SASI_Mm02_00344331 predicted 670
8 SASI_Mm01_00053078 predicted 1563
9 SASI_Mm01_00053079 predicted 2148
10 SASI_Mm01_00053080 predicted 1179
11 SASI_Mm01_00053081 predicted 909
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139159
VALIDATED
DPP9 MISSION shRNA Bacterial Glycerol Stock
dipeptidyl-peptidase 9
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139159.4-2669s21c1
Sequence:CCGGAGAACAACCAGCACGGCTATGCTCGAGCATAGCCGTGCTGGTTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139159.4-2730s21c1
Sequence:CCGGTGAGCCCAACCGCTTGCTTATCTCGAGATAAGCAAGCGGTTGGGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139159.4-1592s21c1
Sequence:CCGGTCACCAACGTCTGGATCAATGCTCGAGCATTGATCCAGACGTTGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139159.4-3236s21c1
Sequence:CCGGAGAGGCCAGAAGAGACTCAGACTCGAGTCTGAGTCTCTTCTGGCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139159.4-2474s21c1
Sequence:CCGGAGTTCGTGGCCGAGAAGTATGCTCGAGCATACTTCTCGGCCACGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139159.4-3127s21c1
Sequence:CCGGTTTATGTCCGCTGCTTCTTGGCTCGAGCCAAGAAGCAGCGGACATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139159.4-1157s21c1
Sequence:CCGGAGACGCTGCGAATCCTGTATGCTCGAGCATACAGGATTCGCAGCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139159.4-2637s21c1
Sequence:CCGGAGGGTACACTGAGCGCTACATCTCGAGATGTAGCGCTCAGTGTACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139159.4-1381s21c1
Sequence:CCGGTTCCCGAAGGTGGAGTACATCCTCGAGGATGTACTCCACCTTCGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_139159.2-884s1c1
Sequence:CCGGCCCTATGAAACCGCTGGAAATCTCGAGATTTCCAGCGGTTTCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139159.2-575s1c1
Sequence:CCGGCCGCCTCTACTACCTGGGAATCTCGAGATTCCCAGGTAGTAGAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_139159.2-2930s1c1
Sequence:CCGGGCTGCACTTTCTACAGGAATACTCGAGTATTCCTGTAGAAAGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_139159.2-2315s1c1
Sequence:CCGGGCTGGTGAATAACTCCTTCAACTCGAGTTGAAGGAGTTATTCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_139159.2-2871s1c1
Sequence:CCGGCCCAACGAGAGACACAGTATTCTCGAGAATACTGTGTCTCTCGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139159
VALIDATED
DPP9 MISSION shRNA shRNA Plasmid DNA
dipeptidyl-peptidase 9
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139159.4-2669s21c1
Sequence:CCGGAGAACAACCAGCACGGCTATGCTCGAGCATAGCCGTGCTGGTTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139159.4-2730s21c1
Sequence:CCGGTGAGCCCAACCGCTTGCTTATCTCGAGATAAGCAAGCGGTTGGGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139159.4-1592s21c1
Sequence:CCGGTCACCAACGTCTGGATCAATGCTCGAGCATTGATCCAGACGTTGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139159.4-3236s21c1
Sequence:CCGGAGAGGCCAGAAGAGACTCAGACTCGAGTCTGAGTCTCTTCTGGCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139159.4-2474s21c1
Sequence:CCGGAGTTCGTGGCCGAGAAGTATGCTCGAGCATACTTCTCGGCCACGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139159.4-3127s21c1
Sequence:CCGGTTTATGTCCGCTGCTTCTTGGCTCGAGCCAAGAAGCAGCGGACATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139159.4-1157s21c1
Sequence:CCGGAGACGCTGCGAATCCTGTATGCTCGAGCATACAGGATTCGCAGCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139159.4-2637s21c1
Sequence:CCGGAGGGTACACTGAGCGCTACATCTCGAGATGTAGCGCTCAGTGTACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139159.4-1381s21c1
Sequence:CCGGTTCCCGAAGGTGGAGTACATCCTCGAGGATGTACTCCACCTTCGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_139159.2-884s1c1
Sequence:CCGGCCCTATGAAACCGCTGGAAATCTCGAGATTTCCAGCGGTTTCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139159.2-575s1c1
Sequence:CCGGCCGCCTCTACTACCTGGGAATCTCGAGATTCCCAGGTAGTAGAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_139159.2-2930s1c1
Sequence:CCGGGCTGCACTTTCTACAGGAATACTCGAGTATTCCTGTAGAAAGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_139159.2-2315s1c1
Sequence:CCGGGCTGGTGAATAACTCCTTCAACTCGAGTTGAAGGAGTTATTCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_139159.2-2871s1c1
Sequence:CCGGCCCAACGAGAGACACAGTATTCTCGAGAATACTGTGTCTCTCGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139159
VALIDATED
DPP9 MISSION shRNA Lentiviral Transduction Particles
dipeptidyl-peptidase 9
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139159.4-2669s21c1
Sequence:CCGGAGAACAACCAGCACGGCTATGCTCGAGCATAGCCGTGCTGGTTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139159.4-2730s21c1
Sequence:CCGGTGAGCCCAACCGCTTGCTTATCTCGAGATAAGCAAGCGGTTGGGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139159.4-1592s21c1
Sequence:CCGGTCACCAACGTCTGGATCAATGCTCGAGCATTGATCCAGACGTTGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139159.4-3236s21c1
Sequence:CCGGAGAGGCCAGAAGAGACTCAGACTCGAGTCTGAGTCTCTTCTGGCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139159.4-2474s21c1
Sequence:CCGGAGTTCGTGGCCGAGAAGTATGCTCGAGCATACTTCTCGGCCACGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139159.4-3127s21c1
Sequence:CCGGTTTATGTCCGCTGCTTCTTGGCTCGAGCCAAGAAGCAGCGGACATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139159.4-1157s21c1
Sequence:CCGGAGACGCTGCGAATCCTGTATGCTCGAGCATACAGGATTCGCAGCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139159.4-2637s21c1
Sequence:CCGGAGGGTACACTGAGCGCTACATCTCGAGATGTAGCGCTCAGTGTACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139159.4-1381s21c1
Sequence:CCGGTTCCCGAAGGTGGAGTACATCCTCGAGGATGTACTCCACCTTCGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_139159.2-884s1c1
Sequence:CCGGCCCTATGAAACCGCTGGAAATCTCGAGATTTCCAGCGGTTTCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139159.2-575s1c1
Sequence:CCGGCCGCCTCTACTACCTGGGAATCTCGAGATTCCCAGGTAGTAGAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_139159.2-2930s1c1
Sequence:CCGGGCTGCACTTTCTACAGGAATACTCGAGTATTCCTGTAGAAAGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_139159.2-2315s1c1
Sequence:CCGGGCTGGTGAATAACTCCTTCAACTCGAGTTGAAGGAGTTATTCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_139159.2-2871s1c1
Sequence:CCGGCCCAACGAGAGACACAGTATTCTCGAGAATACTGTGTCTCTCGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172624
DPP9 MISSION shRNA Bacterial Glycerol Stock
dipeptidyl-peptidase 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172624.1-3093s1c1
Sequence:CCGGCGAGCAATGAAACTGAAGGTACTCGAGTACCTTCAGTTTCATTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172624.1-388s1c1
Sequence:CCGGCCGTCTCTATTACCTCGGAATCTCGAGATTCCGAGGTAATAGAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172624.1-2683s1c1
Sequence:CCGGCCCAAACGAGAGACATAGCATCTCGAGATGCTATGTCTCTCGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172624.1-589s1c1
Sequence:CCGGCGGAATCACCTCTTATGACTTCTCGAGAAGTCATAAGAGGTGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172624.1-1596s1c1
Sequence:CCGGGCCCTACAGAAGATGAGTTTACTCGAGTAAACTCATCTTCTGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172624
DPP9 MISSION shRNA shRNA Plasmid DNA
dipeptidyl-peptidase 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172624.1-3093s1c1
Sequence:CCGGCGAGCAATGAAACTGAAGGTACTCGAGTACCTTCAGTTTCATTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172624.1-388s1c1
Sequence:CCGGCCGTCTCTATTACCTCGGAATCTCGAGATTCCGAGGTAATAGAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172624.1-2683s1c1
Sequence:CCGGCCCAAACGAGAGACATAGCATCTCGAGATGCTATGTCTCTCGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172624.1-589s1c1
Sequence:CCGGCGGAATCACCTCTTATGACTTCTCGAGAAGTCATAAGAGGTGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172624.1-1596s1c1
Sequence:CCGGGCCCTACAGAAGATGAGTTTACTCGAGTAAACTCATCTTCTGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172624
DPP9 MISSION shRNA Lentiviral Transduction Particles
dipeptidyl-peptidase 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172624.1-3093s1c1
Sequence:CCGGCGAGCAATGAAACTGAAGGTACTCGAGTACCTTCAGTTTCATTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172624.1-388s1c1
Sequence:CCGGCCGTCTCTATTACCTCGGAATCTCGAGATTCCGAGGTAATAGAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172624.1-2683s1c1
Sequence:CCGGCCCAAACGAGAGACATAGCATCTCGAGATGCTATGTCTCTCGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172624.1-589s1c1
Sequence:CCGGCGGAATCACCTCTTATGACTTCTCGAGAAGTCATAAGAGGTGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172624.1-1596s1c1
Sequence:CCGGGCCCTACAGAAGATGAGTTTACTCGAGTAAACTCATCTTCTGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks