EMAIL THIS PAGE TO A FRIEND

DPPA2

developmental pluripotency associated 2

49 Gene Product Result for
Synonyms: CT100 ECAT15-2 PESCRG1
UniProtKB ID: Q7Z7J5, Q8WVF0
Gene ID:
Mouse(73703) developmental pluripotency associated 2
Rat(685364) developmental pluripotency associated 2
domestic guinea pig(100730547) developmental pluripotency associated 2
dog(607166) developmental pluripotency associated 2
domestic cat(101084820) developmental pluripotency associated 2
cow(613891) developmental pluripotency associated 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028615 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028615 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028615 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138815 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138815 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138815 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU146891 MISSION® esiRNA esiRNA human DPPA2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138815 Rosetta Predictions human pricing
XM_001063497 Rosetta Predictions rat pricing
NM_028615 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138815 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120856 predicted 501
2 SASI_Hs02_00363980 predicted 563
3 SASI_Hs01_00120857 predicted 590
4 SASI_Hs01_00120859 predicted 1131
5 SASI_Hs01_00120860 predicted 646
6 SASI_Hs01_00120861 predicted 411
7 SASI_Hs02_00363981 predicted 532
8 SASI_Hs01_00120862 predicted 678
9 SASI_Hs01_00120865 predicted 834
10 SASI_Hs02_00363982 predicted 637
11 SASI_Hs01_00120858 predicted 1092
12 SASI_Hs01_00120863 predicted 1161
13 SASI_Hs01_00120864 predicted 1059
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063497 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00307320 predicted 584
2 SASI_Rn02_00307321 predicted 378
3 SASI_Rn02_00307322 predicted 576
4 SASI_Rn02_00307323 predicted 210
5 SASI_Rn02_00307324 predicted 219
6 SASI_Rn02_00307325 predicted 240
7 SASI_Rn02_00307326 predicted 467
8 SASI_Rn02_00307327 predicted 244
9 SASI_Rn02_00307328 predicted 505
10 SASI_Rn02_00307329 predicted 297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028615 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177864 predicted 341
2 SASI_Mm01_00177865 predicted 509
3 SASI_Mm01_00177866 predicted 680
4 SASI_Mm01_00177867 predicted 776
5 SASI_Mm01_00177868 predicted 815
6 SASI_Mm01_00177870 predicted 286
7 SASI_Mm01_00177871 predicted 575
8 SASI_Mm02_00334110 predicted 531
9 SASI_Mm01_00177873 predicted 826
10 SASI_Mm02_00334111 predicted 630
11 SASI_Mm01_00177869 predicted 716
12 SASI_Mm01_00177872 predicted 268
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028615
VALIDATED
DPPA2 MISSION shRNA Bacterial Glycerol Stock
developmental pluripotency associated 2
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194082    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028615.1-1371s1c1
Sequence:CCGGGCTGGATTTGCATCACTCTAACTCGAGTTAGAGTGATGCAAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028615.1-579s1c1
Sequence:CCGGCGGAGACACTCCTATTCTAAACTCGAGTTTAGAATAGGAGTGTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028615.1-358s1c1
Sequence:CCGGCGCAATCAAATGTTTCTTCTTCTCGAGAAGAAGAAACATTTGATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028615.1-903s1c1
Sequence:CCGGGCAGATAAGAAAGGTTGGGTTCTCGAGAACCCAACCTTTCTTATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028615.1-354s1c1
Sequence:CCGGGCTACGCAATCAAATGTTTCTCTCGAGAGAAACATTTGATTGCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028615.1-1021s1c1
Sequence:CCGGGAGTGGAAGATAATTTGCTATCTCGAGATAGCAAATTATCTTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028615.1-427s1c1
Sequence:CCGGGAATCAAACACCCAACCAGAACTCGAGTTCTGGTTGGGTGTTTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028615.1-348s1c1
Sequence:CCGGGACTACGCTACGCAATCAAATCTCGAGATTTGATTGCGTAGCGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028615.1-348s21c1
Sequence:CCGGGACTACGCTACGCAATCAAATCTCGAGATTTGATTGCGTAGCGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028615.1-1388s21c1
Sequence:CCGGCTAACAACACCTCGCTGTATCCTCGAGGATACAGCGAGGTGTTGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028615.1-1021s21c1
Sequence:CCGGGAGTGGAAGATAATTTGCTATCTCGAGATAGCAAATTATCTTCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028615.1-1436s21c1
Sequence:CCGGCTCGTGCTGGATTGGCTAAATCTCGAGATTTAGCCAATCCAGCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028615.1-1359s21c1
Sequence:CCGGTCATGGCCTCGTGCTGGATTTCTCGAGAAATCCAGCACGAGGCCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028615
VALIDATED
DPPA2 MISSION shRNA shRNA Plasmid DNA
developmental pluripotency associated 2
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194082    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028615.1-1371s1c1
Sequence:CCGGGCTGGATTTGCATCACTCTAACTCGAGTTAGAGTGATGCAAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028615.1-579s1c1
Sequence:CCGGCGGAGACACTCCTATTCTAAACTCGAGTTTAGAATAGGAGTGTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028615.1-358s1c1
Sequence:CCGGCGCAATCAAATGTTTCTTCTTCTCGAGAAGAAGAAACATTTGATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028615.1-903s1c1
Sequence:CCGGGCAGATAAGAAAGGTTGGGTTCTCGAGAACCCAACCTTTCTTATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028615.1-354s1c1
Sequence:CCGGGCTACGCAATCAAATGTTTCTCTCGAGAGAAACATTTGATTGCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028615.1-1021s1c1
Sequence:CCGGGAGTGGAAGATAATTTGCTATCTCGAGATAGCAAATTATCTTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028615.1-427s1c1
Sequence:CCGGGAATCAAACACCCAACCAGAACTCGAGTTCTGGTTGGGTGTTTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028615.1-348s1c1
Sequence:CCGGGACTACGCTACGCAATCAAATCTCGAGATTTGATTGCGTAGCGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028615.1-348s21c1
Sequence:CCGGGACTACGCTACGCAATCAAATCTCGAGATTTGATTGCGTAGCGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028615.1-1388s21c1
Sequence:CCGGCTAACAACACCTCGCTGTATCCTCGAGGATACAGCGAGGTGTTGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028615.1-1021s21c1
Sequence:CCGGGAGTGGAAGATAATTTGCTATCTCGAGATAGCAAATTATCTTCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028615.1-1436s21c1
Sequence:CCGGCTCGTGCTGGATTGGCTAAATCTCGAGATTTAGCCAATCCAGCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028615.1-1359s21c1
Sequence:CCGGTCATGGCCTCGTGCTGGATTTCTCGAGAAATCCAGCACGAGGCCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028615
VALIDATED
DPPA2 MISSION shRNA Lentiviral Transduction Particles
developmental pluripotency associated 2
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194082    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028615.1-1371s1c1
Sequence:CCGGGCTGGATTTGCATCACTCTAACTCGAGTTAGAGTGATGCAAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028615.1-579s1c1
Sequence:CCGGCGGAGACACTCCTATTCTAAACTCGAGTTTAGAATAGGAGTGTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028615.1-358s1c1
Sequence:CCGGCGCAATCAAATGTTTCTTCTTCTCGAGAAGAAGAAACATTTGATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028615.1-903s1c1
Sequence:CCGGGCAGATAAGAAAGGTTGGGTTCTCGAGAACCCAACCTTTCTTATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028615.1-354s1c1
Sequence:CCGGGCTACGCAATCAAATGTTTCTCTCGAGAGAAACATTTGATTGCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028615.1-1021s1c1
Sequence:CCGGGAGTGGAAGATAATTTGCTATCTCGAGATAGCAAATTATCTTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028615.1-427s1c1
Sequence:CCGGGAATCAAACACCCAACCAGAACTCGAGTTCTGGTTGGGTGTTTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028615.1-348s1c1
Sequence:CCGGGACTACGCTACGCAATCAAATCTCGAGATTTGATTGCGTAGCGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028615.1-348s21c1
Sequence:CCGGGACTACGCTACGCAATCAAATCTCGAGATTTGATTGCGTAGCGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028615.1-1388s21c1
Sequence:CCGGCTAACAACACCTCGCTGTATCCTCGAGGATACAGCGAGGTGTTGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028615.1-1021s21c1
Sequence:CCGGGAGTGGAAGATAATTTGCTATCTCGAGATAGCAAATTATCTTCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028615.1-1436s21c1
Sequence:CCGGCTCGTGCTGGATTGGCTAAATCTCGAGATTTAGCCAATCCAGCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028615.1-1359s21c1
Sequence:CCGGTCATGGCCTCGTGCTGGATTTCTCGAGAAATCCAGCACGAGGCCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138815
DPPA2 MISSION shRNA Bacterial Glycerol Stock
developmental pluripotency associated 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138815.2-1153s1c1
Sequence:CCGGCCTGTTTGAATACAATGTACTCTCGAGAGTACATTGTATTCAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138815.2-646s1c1
Sequence:CCGGGATATGCCTGAAATGTCACAACTCGAGTTGTGACATTTCAGGCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138815.2-1224s1c1
Sequence:CCGGGAGGAGACAATTTGAATGAATCTCGAGATTCATTCAAATTGTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138815.2-1182s1c1
Sequence:CCGGGATGTACTTTCAGATCATGTACTCGAGTACATGATCTGAAAGTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167162    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138815.2-1188s1c1
Sequence:CCGGCTTTCAGATCATGTAACCTATCTCGAGATAGGTTACATGATCTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000453025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138815.3-598s21c1
Sequence:CCGGAGTTTATCTGAGGCTTCATAGCTCGAGCTATGAAGCCTCAGATAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000448635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138815.3-347s21c1
Sequence:CCGGGACGCAAATATGGAACAAATGCTCGAGCATTTGTTCCATATTTGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138815.3-565s21c1
Sequence:CCGGACTCGGTTTGAGTACTAATGGCTCGAGCCATTAGTACTCAAACCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138815
DPPA2 MISSION shRNA shRNA Plasmid DNA
developmental pluripotency associated 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138815.2-1153s1c1
Sequence:CCGGCCTGTTTGAATACAATGTACTCTCGAGAGTACATTGTATTCAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138815.2-646s1c1
Sequence:CCGGGATATGCCTGAAATGTCACAACTCGAGTTGTGACATTTCAGGCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138815.2-1224s1c1
Sequence:CCGGGAGGAGACAATTTGAATGAATCTCGAGATTCATTCAAATTGTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138815.2-1182s1c1
Sequence:CCGGGATGTACTTTCAGATCATGTACTCGAGTACATGATCTGAAAGTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167162    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138815.2-1188s1c1
Sequence:CCGGCTTTCAGATCATGTAACCTATCTCGAGATAGGTTACATGATCTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000453025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138815.3-598s21c1
Sequence:CCGGAGTTTATCTGAGGCTTCATAGCTCGAGCTATGAAGCCTCAGATAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000448635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138815.3-347s21c1
Sequence:CCGGGACGCAAATATGGAACAAATGCTCGAGCATTTGTTCCATATTTGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138815.3-565s21c1
Sequence:CCGGACTCGGTTTGAGTACTAATGGCTCGAGCCATTAGTACTCAAACCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138815
DPPA2 MISSION shRNA Lentiviral Transduction Particles
developmental pluripotency associated 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138815.2-1153s1c1
Sequence:CCGGCCTGTTTGAATACAATGTACTCTCGAGAGTACATTGTATTCAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138815.2-646s1c1
Sequence:CCGGGATATGCCTGAAATGTCACAACTCGAGTTGTGACATTTCAGGCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138815.2-1224s1c1
Sequence:CCGGGAGGAGACAATTTGAATGAATCTCGAGATTCATTCAAATTGTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138815.2-1182s1c1
Sequence:CCGGGATGTACTTTCAGATCATGTACTCGAGTACATGATCTGAAAGTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167162    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138815.2-1188s1c1
Sequence:CCGGCTTTCAGATCATGTAACCTATCTCGAGATAGGTTACATGATCTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000453025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138815.3-598s21c1
Sequence:CCGGAGTTTATCTGAGGCTTCATAGCTCGAGCTATGAAGCCTCAGATAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000448635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138815.3-347s21c1
Sequence:CCGGGACGCAAATATGGAACAAATGCTCGAGCATTTGTTCCATATTTGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138815.3-565s21c1
Sequence:CCGGACTCGGTTTGAGTACTAATGGCTCGAGCCATTAGTACTCAAACCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks