EMAIL THIS PAGE TO A FRIEND

DPPA3

developmental pluripotency associated 3

44 Gene Product Result for
Synonyms: STELLA
UniProtKB ID: Q6W0C5, Q0P5U3, Q6JZS6
Gene ID:
Human(359787) Summary: This gene encodes a protein that in mice may function as a maternal factor during the preimplantation stage of development. In mice, this gene may play a role in transcriptional repression, cell division, and maintenance of cell pluripotentiality. In humans, related intronless loci are located on chromosomes 14 and X. [provided by RefSeq, Jul 2008]
Mouse(73708) developmental pluripotency-associated 3
Rat(297576) developmental pluripotency-associated 3
cow(616433) developmental pluripotency associated 3
sheep(101104982) developmental pluripotency associated 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199286 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199286 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199286 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139218 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139218 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139218 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199286 Rosetta Predictions human pricing
NM_001047864 Rosetta Predictions rat pricing
NM_139218 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199286 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194846 predicted 323
2 SASI_Hs01_00194847 predicted 628
3 SASI_Hs01_00194848 predicted 249
4 SASI_Hs02_00372705 predicted 361
5 SASI_Hs01_00194849 predicted 207
6 SASI_Hs01_00194850 predicted 779
7 SASI_Hs01_00194851 predicted 614
8 SASI_Hs02_00372706 predicted 445
9 SASI_Hs01_00194852 predicted 506
10 SASI_Hs02_00372707 predicted 214
11 SASI_Hs01_00194843 predicted 450
12 SASI_Hs01_00194844 predicted 705
13 SASI_Hs01_00194845 predicted 723
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047864 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206315 predicted 284
2 SASI_Rn02_00206316 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139218 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092224 predicted 540
2 SASI_Mm02_00339923 predicted 683
3 SASI_Mm02_00339924 predicted 639
4 SASI_Mm01_00092225 predicted 401
5 SASI_Mm01_00092226 predicted 416
6 SASI_Mm01_00092227 predicted 493
7 SASI_Mm01_00092228 predicted 390
8 SASI_Mm01_00092229 predicted 437
9 SASI_Mm01_00092230 predicted 360
10 SASI_Mm01_00092231 predicted 280
11 SASI_Mm01_00092232 predicted 207
12 SASI_Mm01_00092233 predicted 208
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199286
DPPA3 MISSION shRNA Bacterial Glycerol Stock
developmental pluripotency associated 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199286.2-475s21c1
Sequence:CCGGTGCAGTTTCTGCGTGTCTAATCTCGAGATTAGACACGCAGAAACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199286.2-545s21c1
Sequence:CCGGCACTTCAGCCATAAATCTTATCTCGAGATAAGATTTATGGCTGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199286.2-621s21c1
Sequence:CCGGCTATGCTAGTATAGACTATACCTCGAGGTATAGTCTATACTAGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199286.2-187s21c1
Sequence:CCGGTTGATAAAGAACCTTAGTAACCTCGAGGTTACTAAGGTTCTTTATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172771    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199286.2-808s1c1
Sequence:CCGGCCATGTGTCTTAGAAGCCCAACTCGAGTTGGGCTTCTAAGACACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167938    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199286.2-824s1c1
Sequence:CCGGCCCAAAGTCAGTGAGATGAAACTCGAGTTTCATCTCACTGACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199286.2-185s1c1
Sequence:CCGGCGTTGATAAAGAACCTTAGTACTCGAGTACTAAGGTTCTTTATCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199286
DPPA3 MISSION shRNA shRNA Plasmid DNA
developmental pluripotency associated 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199286.2-475s21c1
Sequence:CCGGTGCAGTTTCTGCGTGTCTAATCTCGAGATTAGACACGCAGAAACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199286.2-545s21c1
Sequence:CCGGCACTTCAGCCATAAATCTTATCTCGAGATAAGATTTATGGCTGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199286.2-621s21c1
Sequence:CCGGCTATGCTAGTATAGACTATACCTCGAGGTATAGTCTATACTAGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199286.2-187s21c1
Sequence:CCGGTTGATAAAGAACCTTAGTAACCTCGAGGTTACTAAGGTTCTTTATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172771    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199286.2-808s1c1
Sequence:CCGGCCATGTGTCTTAGAAGCCCAACTCGAGTTGGGCTTCTAAGACACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167938    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199286.2-824s1c1
Sequence:CCGGCCCAAAGTCAGTGAGATGAAACTCGAGTTTCATCTCACTGACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199286.2-185s1c1
Sequence:CCGGCGTTGATAAAGAACCTTAGTACTCGAGTACTAAGGTTCTTTATCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199286
DPPA3 MISSION shRNA Lentiviral Transduction Particles
developmental pluripotency associated 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199286.2-475s21c1
Sequence:CCGGTGCAGTTTCTGCGTGTCTAATCTCGAGATTAGACACGCAGAAACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199286.2-545s21c1
Sequence:CCGGCACTTCAGCCATAAATCTTATCTCGAGATAAGATTTATGGCTGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199286.2-621s21c1
Sequence:CCGGCTATGCTAGTATAGACTATACCTCGAGGTATAGTCTATACTAGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199286.2-187s21c1
Sequence:CCGGTTGATAAAGAACCTTAGTAACCTCGAGGTTACTAAGGTTCTTTATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172771    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199286.2-808s1c1
Sequence:CCGGCCATGTGTCTTAGAAGCCCAACTCGAGTTGGGCTTCTAAGACACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167938    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199286.2-824s1c1
Sequence:CCGGCCCAAAGTCAGTGAGATGAAACTCGAGTTTCATCTCACTGACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199286.2-185s1c1
Sequence:CCGGCGTTGATAAAGAACCTTAGTACTCGAGTACTAAGGTTCTTTATCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139218
DPPA3 MISSION shRNA Bacterial Glycerol Stock
developmental pluripotency associated 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139218.1-127s1c1
Sequence:CCGGCCAATGAAGGACCCTGAAACTCTCGAGAGTTTCAGGGTCCTTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139218.1-402s1c1
Sequence:CCGGGATGAGAAGACTTGTTCGGATCTCGAGATCCGAACAAGTCTTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139218.1-517s1c1
Sequence:CCGGGATCCCTCTGAGAATGCGAAACTCGAGTTTCGCATTCTCAGAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139218.1-441s1c1
Sequence:CCGGGCTCGAAGGAAATGAGTTTGACTCGAGTCAAACTCATTTCCTTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139218.1-494s1c1
Sequence:CCGGCTTTCTGCCATTATCAAAGATCTCGAGATCTTTGATAATGGCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139218.1-397s1c1
Sequence:CCGGGCAAAGATGAGAAGACTTGTTCTCGAGAACAAGTCTTCTCATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139218.1-142s1c1
Sequence:CCGGGAAACTCCTCAGAAGAAAGATCTCGAGATCTTTCTTCTGAGGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139218.1-595s1c1
Sequence:CCGGCAGCAGATGTGAAAGCTATTTCTCGAGAAATAGCTTTCACATCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198444    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139218.1-643s1c1
Sequence:CCGGGCTGGGAAATCTTAACTTGTTCTCGAGAACAAGTTAAGATTTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139218
DPPA3 MISSION shRNA shRNA Plasmid DNA
developmental pluripotency associated 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139218.1-127s1c1
Sequence:CCGGCCAATGAAGGACCCTGAAACTCTCGAGAGTTTCAGGGTCCTTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139218.1-402s1c1
Sequence:CCGGGATGAGAAGACTTGTTCGGATCTCGAGATCCGAACAAGTCTTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139218.1-517s1c1
Sequence:CCGGGATCCCTCTGAGAATGCGAAACTCGAGTTTCGCATTCTCAGAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139218.1-441s1c1
Sequence:CCGGGCTCGAAGGAAATGAGTTTGACTCGAGTCAAACTCATTTCCTTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139218.1-494s1c1
Sequence:CCGGCTTTCTGCCATTATCAAAGATCTCGAGATCTTTGATAATGGCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139218.1-397s1c1
Sequence:CCGGGCAAAGATGAGAAGACTTGTTCTCGAGAACAAGTCTTCTCATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139218.1-142s1c1
Sequence:CCGGGAAACTCCTCAGAAGAAAGATCTCGAGATCTTTCTTCTGAGGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139218.1-595s1c1
Sequence:CCGGCAGCAGATGTGAAAGCTATTTCTCGAGAAATAGCTTTCACATCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198444    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139218.1-643s1c1
Sequence:CCGGGCTGGGAAATCTTAACTTGTTCTCGAGAACAAGTTAAGATTTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139218
DPPA3 MISSION shRNA Lentiviral Transduction Particles
developmental pluripotency associated 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139218.1-127s1c1
Sequence:CCGGCCAATGAAGGACCCTGAAACTCTCGAGAGTTTCAGGGTCCTTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139218.1-402s1c1
Sequence:CCGGGATGAGAAGACTTGTTCGGATCTCGAGATCCGAACAAGTCTTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139218.1-517s1c1
Sequence:CCGGGATCCCTCTGAGAATGCGAAACTCGAGTTTCGCATTCTCAGAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139218.1-441s1c1
Sequence:CCGGGCTCGAAGGAAATGAGTTTGACTCGAGTCAAACTCATTTCCTTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139218.1-494s1c1
Sequence:CCGGCTTTCTGCCATTATCAAAGATCTCGAGATCTTTGATAATGGCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139218.1-397s1c1
Sequence:CCGGGCAAAGATGAGAAGACTTGTTCTCGAGAACAAGTCTTCTCATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139218.1-142s1c1
Sequence:CCGGGAAACTCCTCAGAAGAAAGATCTCGAGATCTTTCTTCTGAGGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139218.1-595s1c1
Sequence:CCGGCAGCAGATGTGAAAGCTATTTCTCGAGAAATAGCTTTCACATCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198444    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139218.1-643s1c1
Sequence:CCGGGCTGGGAAATCTTAACTTGTTCTCGAGAACAAGTTAAGATTTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks