EMAIL THIS PAGE TO A FRIEND

DPPA4

developmental pluripotency associated 4

52 Gene Product Result for
Synonyms: 2410091M23Rik
UniProtKB ID: Q7L190, A8K4M7, Q9H9N5, Q9NVI6
Gene ID:
Mouse(73693) developmental pluripotency associated 4
cow(783813) developmental pluripotency associated 4
domestic cat(101085065) developmental pluripotency associated 4
domestic guinea pig(100730821) developmental pluripotency associated 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1419 Human DPPA4 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028610 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028610 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028610 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018189 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018189 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018189 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018189 Rosetta Predictions human pricing
NM_001018002 Rosetta Predictions mouse pricing
NM_028610 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018189 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070111 predicted 736
2 SASI_Hs01_00070112 predicted 960
3 SASI_Hs01_00070113 predicted 840
4 SASI_Hs01_00070115 predicted 983
5 SASI_Hs01_00070116 predicted 957
6 SASI_Hs01_00070117 predicted 860
7 SASI_Hs02_00351456 predicted 221
8 SASI_Hs01_00070114 predicted 740
9 SASI_Hs02_00351457 predicted 281
10 SASI_Hs01_00070119 predicted 189
11 SASI_Hs01_00070118 predicted 901
12 SASI_Hs01_00070120 predicted 195
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018002 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287530 predicted 630
2 SASI_Mm02_00287531 predicted 958
3 SASI_Mm02_00287532 predicted 813
4 SASI_Mm02_00287533 predicted 519
5 SASI_Mm02_00287534 predicted 1133
6 SASI_Mm02_00287535 predicted 493
7 SASI_Mm02_00287536 predicted 891
8 SASI_Mm02_00287537 predicted 855
9 SASI_Mm02_00287538 predicted 557
10 SASI_Mm02_00287539 predicted 1038
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028610 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334098 predicted 792
2 SASI_Mm01_00143454 predicted 1116
3 SASI_Mm01_00143455 predicted 972
4 SASI_Mm01_00143456 predicted 675
5 SASI_Mm01_00143457 predicted 1284
6 SASI_Mm01_00143458 predicted 654
7 SASI_Mm01_00143460 predicted 1049
8 SASI_Mm01_00143461 predicted 1002
9 SASI_Mm01_00143462 predicted 710
10 SASI_Mm01_00143463 predicted 1197
11 SASI_Mm01_00143459 predicted 1276
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028610
VALIDATED
DPPA4 MISSION shRNA Bacterial Glycerol Stock
developmental pluripotency associated 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028610.1-179s1c1
Sequence:CCGGCGGAGACAGATAATGGTTGTACTCGAGTACAACCATTATCTGTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028610.1-106s1c1
Sequence:CCGGGAATTGCAGATGTCTAGTCAACTCGAGTTGACTAGACATCTGCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028610.1-541s1c1
Sequence:CCGGGAGCAGATACTTGCCTTCATTCTCGAGAATGAAGGCAAGTATCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028610.1-642s1c1
Sequence:CCGGCAGATTTGCATCCAATGCTAACTCGAGTTAGCATTGGATGCAAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329372    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028610.2-1354s21c1
Sequence:CCGGACTGTAAAGACTTGGCTTATACTCGAGTATAAGCCAAGTCTTTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028610.2-401s21c1
Sequence:CCGGTGCTTATAAACGACTCCTTGCCTCGAGGCAAGGAGTCGTTTATAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028610.2-722s21c1
Sequence:CCGGTTCGTCCTCATCAGAAGTCAACTCGAGTTGACTTCTGATGAGGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028610.2-423s21c1
Sequence:CCGGAGGGCTTTCCCAGAACAAATGCTCGAGCATTTGTTCTGGGAAAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028610.2-379s21c1
Sequence:CCGGGCAGCAAAGGCCAGAAATTAGCTCGAGCTAATTTCTGGCCTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028610
VALIDATED
DPPA4 MISSION shRNA shRNA Plasmid DNA
developmental pluripotency associated 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028610.1-179s1c1
Sequence:CCGGCGGAGACAGATAATGGTTGTACTCGAGTACAACCATTATCTGTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028610.1-106s1c1
Sequence:CCGGGAATTGCAGATGTCTAGTCAACTCGAGTTGACTAGACATCTGCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028610.1-541s1c1
Sequence:CCGGGAGCAGATACTTGCCTTCATTCTCGAGAATGAAGGCAAGTATCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028610.1-642s1c1
Sequence:CCGGCAGATTTGCATCCAATGCTAACTCGAGTTAGCATTGGATGCAAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329372    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028610.2-1354s21c1
Sequence:CCGGACTGTAAAGACTTGGCTTATACTCGAGTATAAGCCAAGTCTTTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028610.2-401s21c1
Sequence:CCGGTGCTTATAAACGACTCCTTGCCTCGAGGCAAGGAGTCGTTTATAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028610.2-722s21c1
Sequence:CCGGTTCGTCCTCATCAGAAGTCAACTCGAGTTGACTTCTGATGAGGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028610.2-423s21c1
Sequence:CCGGAGGGCTTTCCCAGAACAAATGCTCGAGCATTTGTTCTGGGAAAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028610.2-379s21c1
Sequence:CCGGGCAGCAAAGGCCAGAAATTAGCTCGAGCTAATTTCTGGCCTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028610
VALIDATED
DPPA4 MISSION shRNA Lentiviral Transduction Particles
developmental pluripotency associated 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028610.1-179s1c1
Sequence:CCGGCGGAGACAGATAATGGTTGTACTCGAGTACAACCATTATCTGTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028610.1-106s1c1
Sequence:CCGGGAATTGCAGATGTCTAGTCAACTCGAGTTGACTAGACATCTGCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028610.1-541s1c1
Sequence:CCGGGAGCAGATACTTGCCTTCATTCTCGAGAATGAAGGCAAGTATCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028610.1-642s1c1
Sequence:CCGGCAGATTTGCATCCAATGCTAACTCGAGTTAGCATTGGATGCAAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329372    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028610.2-1354s21c1
Sequence:CCGGACTGTAAAGACTTGGCTTATACTCGAGTATAAGCCAAGTCTTTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028610.2-401s21c1
Sequence:CCGGTGCTTATAAACGACTCCTTGCCTCGAGGCAAGGAGTCGTTTATAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028610.2-722s21c1
Sequence:CCGGTTCGTCCTCATCAGAAGTCAACTCGAGTTGACTTCTGATGAGGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028610.2-423s21c1
Sequence:CCGGAGGGCTTTCCCAGAACAAATGCTCGAGCATTTGTTCTGGGAAAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028610.2-379s21c1
Sequence:CCGGGCAGCAAAGGCCAGAAATTAGCTCGAGCTAATTTCTGGCCTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018189
DPPA4 MISSION shRNA Bacterial Glycerol Stock
developmental pluripotency associated 4
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018189.1-560s1c1
Sequence:CCGGGAGTTAATACAGTTGTGGTGACTCGAGTCACCACAACTGTATTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018189.1-861s1c1
Sequence:CCGGCAAATGTGTTCACAGGAACAACTCGAGTTGTTCCTGTGAACACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018189.1-469s1c1
Sequence:CCGGCTGCAAAGTTCTGAGACACATCTCGAGATGTGTCTCAGAACTTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018189.1-261s1c1
Sequence:CCGGGCCACCTGTTAATCTGATTCACTCGAGTGAATCAGATTAACAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018189.1-228s1c1
Sequence:CCGGGAAGATACCAATCCCTCCATTCTCGAGAATGGAGGGATTGGTATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018189.1-786s1c1
Sequence:CCGGGAGAGTGAGTGCACTCTTCTTCTCGAGAAGAAGAGTGCACTCACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018189.1-79s1c1
Sequence:CCGGGAGGATCAGCAGGCTTCTAATCTCGAGATTAGAAGCCTGCTGATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018189.1-831s1c1
Sequence:CCGGCCCGCACCTTGAAGACAATATCTCGAGATATTGTCTTCAAGGTGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018189.1-739s1c1
Sequence:CCGGCTGCAGTTTCATGCTGGTCAACTCGAGTTGACCAGCATGAAACTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018189.1-547s1c1
Sequence:CCGGGCTCTCCTTGAGGGAGTTAATCTCGAGATTAACTCCCTCAAGGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018189.1-343s1c1
Sequence:CCGGGATGCATATAAGCGCCTGTGTCTCGAGACACAGGCGCTTATATGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018189.1-110s1c1
Sequence:CCGGCAATTGCTTTGCCAGGAACATCTCGAGATGTTCCTGGCAAAGCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018189.1-310s1c1
Sequence:CCGGCAATTGAAGCTGAGCTCCAAACTCGAGTTTGGAGCTCAGCTTCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018189
DPPA4 MISSION shRNA shRNA Plasmid DNA
developmental pluripotency associated 4
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018189.1-560s1c1
Sequence:CCGGGAGTTAATACAGTTGTGGTGACTCGAGTCACCACAACTGTATTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018189.1-861s1c1
Sequence:CCGGCAAATGTGTTCACAGGAACAACTCGAGTTGTTCCTGTGAACACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018189.1-469s1c1
Sequence:CCGGCTGCAAAGTTCTGAGACACATCTCGAGATGTGTCTCAGAACTTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018189.1-261s1c1
Sequence:CCGGGCCACCTGTTAATCTGATTCACTCGAGTGAATCAGATTAACAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018189.1-228s1c1
Sequence:CCGGGAAGATACCAATCCCTCCATTCTCGAGAATGGAGGGATTGGTATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018189.1-786s1c1
Sequence:CCGGGAGAGTGAGTGCACTCTTCTTCTCGAGAAGAAGAGTGCACTCACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018189.1-79s1c1
Sequence:CCGGGAGGATCAGCAGGCTTCTAATCTCGAGATTAGAAGCCTGCTGATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018189.1-831s1c1
Sequence:CCGGCCCGCACCTTGAAGACAATATCTCGAGATATTGTCTTCAAGGTGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018189.1-739s1c1
Sequence:CCGGCTGCAGTTTCATGCTGGTCAACTCGAGTTGACCAGCATGAAACTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018189.1-547s1c1
Sequence:CCGGGCTCTCCTTGAGGGAGTTAATCTCGAGATTAACTCCCTCAAGGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018189.1-343s1c1
Sequence:CCGGGATGCATATAAGCGCCTGTGTCTCGAGACACAGGCGCTTATATGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018189.1-110s1c1
Sequence:CCGGCAATTGCTTTGCCAGGAACATCTCGAGATGTTCCTGGCAAAGCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018189.1-310s1c1
Sequence:CCGGCAATTGAAGCTGAGCTCCAAACTCGAGTTTGGAGCTCAGCTTCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018189
DPPA4 MISSION shRNA Lentiviral Transduction Particles
developmental pluripotency associated 4
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018189.1-560s1c1
Sequence:CCGGGAGTTAATACAGTTGTGGTGACTCGAGTCACCACAACTGTATTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018189.1-861s1c1
Sequence:CCGGCAAATGTGTTCACAGGAACAACTCGAGTTGTTCCTGTGAACACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018189.1-469s1c1
Sequence:CCGGCTGCAAAGTTCTGAGACACATCTCGAGATGTGTCTCAGAACTTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018189.1-261s1c1
Sequence:CCGGGCCACCTGTTAATCTGATTCACTCGAGTGAATCAGATTAACAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018189.1-228s1c1
Sequence:CCGGGAAGATACCAATCCCTCCATTCTCGAGAATGGAGGGATTGGTATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018189.1-786s1c1
Sequence:CCGGGAGAGTGAGTGCACTCTTCTTCTCGAGAAGAAGAGTGCACTCACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018189.1-79s1c1
Sequence:CCGGGAGGATCAGCAGGCTTCTAATCTCGAGATTAGAAGCCTGCTGATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018189.1-831s1c1
Sequence:CCGGCCCGCACCTTGAAGACAATATCTCGAGATATTGTCTTCAAGGTGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018189.1-739s1c1
Sequence:CCGGCTGCAGTTTCATGCTGGTCAACTCGAGTTGACCAGCATGAAACTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018189.1-547s1c1
Sequence:CCGGGCTCTCCTTGAGGGAGTTAATCTCGAGATTAACTCCCTCAAGGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018189.1-343s1c1
Sequence:CCGGGATGCATATAAGCGCCTGTGTCTCGAGACACAGGCGCTTATATGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018189.1-110s1c1
Sequence:CCGGCAATTGCTTTGCCAGGAACATCTCGAGATGTTCCTGGCAAAGCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018189.1-310s1c1
Sequence:CCGGCAATTGAAGCTGAGCTCCAAACTCGAGTTTGGAGCTCAGCTTCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks