EMAIL THIS PAGE TO A FRIEND

DPPA5

developmental pluripotency associated 5

Synonyms: ESG1
UniProtKB ID: A6NC42, B2RPQ7
Gene ID:
Human(340168) Summary: This gene encodes a protein that may function in the control of cell pluripotency and early embryogenesis. Expression of this gene is a specific marker for pluripotent stem cells. Pseudogenes of this gene are located on the short arm of chromosome 10 and the long arm of chromosomes 14 and 19. [provided by RefSeq, Dec 2010]
Rat(301101) developmental pluripotency associated 5
dog(481878) developmental pluripotency associated 5
domestic cat(101092610) developmental pluripotency associated 5
Domestic Rabbit(100328658) developmental pluripotency associated 5
32 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1420 Human DPPA5 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001025290 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001025290 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001025290 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025290 Rosetta Predictions human pricing
XM_236761 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025290 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207191 predicted 208
2 SASI_Hs01_00207192 predicted 337
3 SASI_Hs01_00207193 predicted 204
4 SASI_Hs01_00207194 predicted 314
5 SASI_Hs01_00207195 predicted 207
6 SASI_Hs01_00207196 predicted 301
7 SASI_Hs01_00207197 predicted 305
8 SASI_Hs01_00207198 predicted 295
9 SASI_Hs01_00207199 predicted 205
10 SASI_Hs01_00207200 predicted 201
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236761 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390400 predicted 48
2 SASI_Rn02_00390401 predicted 180
3 SASI_Rn02_00390402 predicted 235
4 SASI_Rn02_00390403 predicted 190
5 SASI_Rn02_00390404 predicted 213
6 SASI_Rn02_00390405 predicted 145
7 SASI_Rn02_00390406 predicted 276
8 SASI_Rn02_00390407 predicted 62
9 SASI_Rn02_00390408 predicted 197
10 SASI_Rn02_00390409 predicted 172
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025290
DPPA5 MISSION shRNA Bacterial Glycerol Stock
developmental pluripotency associated 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025290.1-125s1c1
Sequence:CCGGCGGATCTCGAATCCCTTACATCTCGAGATGTAAGGGATTCGAGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025290.1-62s1c1
Sequence:CCGGCCTGAAAGATCCAGAGGTGTTCTCGAGAACACCTCTGGATCTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025290.1-56s1c1
Sequence:CCGGCGAAGACCTGAAAGATCCAGACTCGAGTCTGGATCTTTCAGGTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162789    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025290.1-451s1c1
Sequence:CCGGCAGCCTAAAGAGTTAAGGGAACTCGAGTTCCCTTAACTCTTTAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025290.1-51s1c1
Sequence:CCGGGTTCCCGAAGACCTGAAAGATCTCGAGATCTTTCAGGTCTTCGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025290
DPPA5 MISSION shRNA shRNA Plasmid DNA
developmental pluripotency associated 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025290.1-125s1c1
Sequence:CCGGCGGATCTCGAATCCCTTACATCTCGAGATGTAAGGGATTCGAGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025290.1-62s1c1
Sequence:CCGGCCTGAAAGATCCAGAGGTGTTCTCGAGAACACCTCTGGATCTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025290.1-56s1c1
Sequence:CCGGCGAAGACCTGAAAGATCCAGACTCGAGTCTGGATCTTTCAGGTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162789    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025290.1-451s1c1
Sequence:CCGGCAGCCTAAAGAGTTAAGGGAACTCGAGTTCCCTTAACTCTTTAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025290.1-51s1c1
Sequence:CCGGGTTCCCGAAGACCTGAAAGATCTCGAGATCTTTCAGGTCTTCGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025290
DPPA5 MISSION shRNA Lentiviral Transduction Particles
developmental pluripotency associated 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025290.1-125s1c1
Sequence:CCGGCGGATCTCGAATCCCTTACATCTCGAGATGTAAGGGATTCGAGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025290.1-62s1c1
Sequence:CCGGCCTGAAAGATCCAGAGGTGTTCTCGAGAACACCTCTGGATCTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025290.1-56s1c1
Sequence:CCGGCGAAGACCTGAAAGATCCAGACTCGAGTCTGGATCTTTCAGGTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162789    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025290.1-451s1c1
Sequence:CCGGCAGCCTAAAGAGTTAAGGGAACTCGAGTTCCCTTAACTCTTTAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025290.1-51s1c1
Sequence:CCGGGTTCCCGAAGACCTGAAAGATCTCGAGATCTTTCAGGTCTTCGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks