EMAIL THIS PAGE TO A FRIEND

DPT

dermatopontin

110 Gene Product Result for
Synonyms: TRAMP
UniProtKB ID: Q07507, A8K981, Q8N4R2, Q9UIX8
Gene ID:
Human(1805) Summary: Dermatopontin is an extracellular matrix protein with possible functions in cell-matrix interactions and matrix assembly. The protein is found in various tissues and many of its tyrosine residues are sulphated. Dermatopontin is postulated to modify the behavior of TGF-beta through interaction with decorin. [provided by RefSeq, Jul 2008]
Mouse(56429) dermatopontin
Rat(289178) dermatopontin
sheep(101122371) dermatopontin
fruit fly(246861) depilated
fruit fly(37183) Diptericin
domestic cat(101101023) dermatopontin
cow(504963) dermatopontin
dog(490355) dermatopontin
chicken(768904) dermatopontin
Gene Class: Cell_Adhesion
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019759 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019759 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019759 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001937 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001937 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001937 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001937 Rosetta Predictions human pricing
NM_001105965 Rosetta Predictions rat pricing
NM_019759 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001937 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023633 predicted 836
2 SASI_Hs02_00332839 predicted 742
3 SASI_Hs01_00023634 predicted 203
4 SASI_Hs01_00023635 predicted 490
5 SASI_Hs01_00023636 predicted 429
6 SASI_Hs01_00023638 predicted 595
7 SASI_Hs01_00023639 predicted 882
8 SASI_Hs01_00023640 predicted 900
9 SASI_Hs02_00332840 predicted 497
10 SASI_Hs01_00023641 predicted 482
11 SASI_Hs01_00023637 predicted 616
12 SASI_Hs01_00023642 predicted 218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105965 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214292 predicted 890
2 SASI_Rn02_00214293 predicted 258
3 SASI_Rn02_00214294 predicted 280
4 SASI_Rn02_00214295 predicted 440
5 SASI_Rn02_00214296 predicted 1052
6 SASI_Rn02_00214297 predicted 383
7 SASI_Rn02_00214298 predicted 393
8 SASI_Rn02_00214299 predicted 1073
9 SASI_Rn02_00214300 predicted 353
10 SASI_Rn02_00214301 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019759 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046763 predicted 466
2 SASI_Mm01_00046764 predicted 936
3 SASI_Mm01_00046765 predicted 590
4 SASI_Mm01_00046766 predicted 411
5 SASI_Mm01_00046767 predicted 667
6 SASI_Mm01_00046768 predicted 658
7 SASI_Mm01_00046770 predicted 814
8 SASI_Mm01_00046771 predicted 921
9 SASI_Mm01_00046772 predicted 654
10 SASI_Mm02_00324930 predicted 992
11 SASI_Mm01_00046769 predicted 1004
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019759
VALIDATED
DPT MISSION shRNA Bacterial Glycerol Stock
dermatopontin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119302    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019759.1-1246s1c1
Sequence:CCGGCGTCCTCTATTCAAAGATATACTCGAGTATATCTTTGAATAGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019759.1-402s1c1
Sequence:CCGGCTATAGCAAGAGGTGTCCATACTCGAGTATGGACACCTCTTGCTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019759.1-370s1c1
Sequence:CCGGCTGGATCGTGAGTGGCAATTTCTCGAGAAATTGCCACTCACGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019759.1-177s1c1
Sequence:CCGGGAGGAGCATCTTTAGCAAGAACTCGAGTTCTTGCTAAAGATGCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019759.1-504s1c1
Sequence:CCGGGCGAGGAGCAACAACCACTTTCTCGAGAAAGTGGTTGTTGCTCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019759.2-655s21c1
Sequence:CCGGTGAGGGTGTCATATCACATATCTCGAGATATGTGATATGACACCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019759.2-177s21c1
Sequence:CCGGGAGGAGCATCTTTAGCAAGAACTCGAGTTCTTGCTAAAGATGCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019759.2-504s21c1
Sequence:CCGGGCGAGGAGCAACAACCACTTTCTCGAGAAAGTGGTTGTTGCTCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019759.2-402s21c1
Sequence:CCGGCTATAGCAAGAGGTGTCCATACTCGAGTATGGACACCTCTTGCTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019759.2-993s21c1
Sequence:CCGGCTTGAGAGAGGTGGGATAAAGCTCGAGCTTTATCCCACCTCTCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019759
VALIDATED
DPT MISSION shRNA shRNA Plasmid DNA
dermatopontin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119302    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019759.1-1246s1c1
Sequence:CCGGCGTCCTCTATTCAAAGATATACTCGAGTATATCTTTGAATAGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019759.1-402s1c1
Sequence:CCGGCTATAGCAAGAGGTGTCCATACTCGAGTATGGACACCTCTTGCTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019759.1-370s1c1
Sequence:CCGGCTGGATCGTGAGTGGCAATTTCTCGAGAAATTGCCACTCACGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019759.1-177s1c1
Sequence:CCGGGAGGAGCATCTTTAGCAAGAACTCGAGTTCTTGCTAAAGATGCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019759.1-504s1c1
Sequence:CCGGGCGAGGAGCAACAACCACTTTCTCGAGAAAGTGGTTGTTGCTCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019759.2-655s21c1
Sequence:CCGGTGAGGGTGTCATATCACATATCTCGAGATATGTGATATGACACCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019759.2-177s21c1
Sequence:CCGGGAGGAGCATCTTTAGCAAGAACTCGAGTTCTTGCTAAAGATGCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019759.2-504s21c1
Sequence:CCGGGCGAGGAGCAACAACCACTTTCTCGAGAAAGTGGTTGTTGCTCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019759.2-402s21c1
Sequence:CCGGCTATAGCAAGAGGTGTCCATACTCGAGTATGGACACCTCTTGCTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019759.2-993s21c1
Sequence:CCGGCTTGAGAGAGGTGGGATAAAGCTCGAGCTTTATCCCACCTCTCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019759
VALIDATED
DPT MISSION shRNA Lentiviral Transduction Particles
dermatopontin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119302    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019759.1-1246s1c1
Sequence:CCGGCGTCCTCTATTCAAAGATATACTCGAGTATATCTTTGAATAGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019759.1-402s1c1
Sequence:CCGGCTATAGCAAGAGGTGTCCATACTCGAGTATGGACACCTCTTGCTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019759.1-370s1c1
Sequence:CCGGCTGGATCGTGAGTGGCAATTTCTCGAGAAATTGCCACTCACGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019759.1-177s1c1
Sequence:CCGGGAGGAGCATCTTTAGCAAGAACTCGAGTTCTTGCTAAAGATGCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019759.1-504s1c1
Sequence:CCGGGCGAGGAGCAACAACCACTTTCTCGAGAAAGTGGTTGTTGCTCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019759.2-655s21c1
Sequence:CCGGTGAGGGTGTCATATCACATATCTCGAGATATGTGATATGACACCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019759.2-177s21c1
Sequence:CCGGGAGGAGCATCTTTAGCAAGAACTCGAGTTCTTGCTAAAGATGCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019759.2-504s21c1
Sequence:CCGGGCGAGGAGCAACAACCACTTTCTCGAGAAAGTGGTTGTTGCTCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019759.2-402s21c1
Sequence:CCGGCTATAGCAAGAGGTGTCCATACTCGAGTATGGACACCTCTTGCTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019759.2-993s21c1
Sequence:CCGGCTTGAGAGAGGTGGGATAAAGCTCGAGCTTTATCCCACCTCTCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001937
DPT MISSION shRNA Bacterial Glycerol Stock
dermatopontin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001937.3-557s1c1
Sequence:CCGGGATCGCCAGTGGAAGTTCATACTCGAGTATGAACTTCCACTGGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001937.3-101s1c1
Sequence:CCGGCAGTATCATGACTACAGCGATCTCGAGATCGCTGTAGTCATGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150731    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001937.3-1036s1c1
Sequence:CCGGGCTAAGCCTGTTTGAATGATACTCGAGTATCATTCAAACAGGCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001937.3-1020s1c1
Sequence:CCGGGTGAAGGTTCTCTACAGCTAACTCGAGTTAGCTGTAGAGAACCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001937.3-79s1c1
Sequence:CCGGCGATTATGGATACCCATACCACTCGAGTGGTATGGGTATCCATAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001937.3-568s1c1
Sequence:CCGGGAAGTTCATAATGTGCCGGATCTCGAGATCCGGCACATTATGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001937.3-207s1c1
Sequence:CCGGGCAAGAAGGAAGGTTCTGACACTCGAGTGTCAGAACCTTCCTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001937.3-420s21c1
Sequence:CCGGACAGCAAGAGGTGCCCATATTCTCGAGAATATGGGCACCTCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001937.3-488s21c1
Sequence:CCGGGACATGATTTCCTACAATTATCTCGAGATAATTGTAGGAAATCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001937.3-782s21c1
Sequence:CCGGCTAGTATCACACTTCTAATAACTCGAGTTATTAGAAGTGTGATACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001937
DPT MISSION shRNA shRNA Plasmid DNA
dermatopontin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001937.3-557s1c1
Sequence:CCGGGATCGCCAGTGGAAGTTCATACTCGAGTATGAACTTCCACTGGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001937.3-101s1c1
Sequence:CCGGCAGTATCATGACTACAGCGATCTCGAGATCGCTGTAGTCATGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150731    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001937.3-1036s1c1
Sequence:CCGGGCTAAGCCTGTTTGAATGATACTCGAGTATCATTCAAACAGGCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001937.3-1020s1c1
Sequence:CCGGGTGAAGGTTCTCTACAGCTAACTCGAGTTAGCTGTAGAGAACCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001937.3-79s1c1
Sequence:CCGGCGATTATGGATACCCATACCACTCGAGTGGTATGGGTATCCATAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001937.3-568s1c1
Sequence:CCGGGAAGTTCATAATGTGCCGGATCTCGAGATCCGGCACATTATGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001937.3-207s1c1
Sequence:CCGGGCAAGAAGGAAGGTTCTGACACTCGAGTGTCAGAACCTTCCTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001937.3-420s21c1
Sequence:CCGGACAGCAAGAGGTGCCCATATTCTCGAGAATATGGGCACCTCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001937.3-488s21c1
Sequence:CCGGGACATGATTTCCTACAATTATCTCGAGATAATTGTAGGAAATCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001937.3-782s21c1
Sequence:CCGGCTAGTATCACACTTCTAATAACTCGAGTTATTAGAAGTGTGATACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001937
DPT MISSION shRNA Lentiviral Transduction Particles
dermatopontin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001937.3-557s1c1
Sequence:CCGGGATCGCCAGTGGAAGTTCATACTCGAGTATGAACTTCCACTGGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001937.3-101s1c1
Sequence:CCGGCAGTATCATGACTACAGCGATCTCGAGATCGCTGTAGTCATGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150731    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001937.3-1036s1c1
Sequence:CCGGGCTAAGCCTGTTTGAATGATACTCGAGTATCATTCAAACAGGCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001937.3-1020s1c1
Sequence:CCGGGTGAAGGTTCTCTACAGCTAACTCGAGTTAGCTGTAGAGAACCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001937.3-79s1c1
Sequence:CCGGCGATTATGGATACCCATACCACTCGAGTGGTATGGGTATCCATAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001937.3-568s1c1
Sequence:CCGGGAAGTTCATAATGTGCCGGATCTCGAGATCCGGCACATTATGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001937.3-207s1c1
Sequence:CCGGGCAAGAAGGAAGGTTCTGACACTCGAGTGTCAGAACCTTCCTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001937.3-420s21c1
Sequence:CCGGACAGCAAGAGGTGCCCATATTCTCGAGAATATGGGCACCTCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001937.3-488s21c1
Sequence:CCGGGACATGATTTCCTACAATTATCTCGAGATAATTGTAGGAAATCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001937.3-782s21c1
Sequence:CCGGCTAGTATCACACTTCTAATAACTCGAGTTATTAGAAGTGTGATACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks