EMAIL THIS PAGE TO A FRIEND

DPY19L1

dpy-19-like 1 (C. elegans)

148 Gene Product Result for
UniProtKB ID: Q2PZI1, O94954, Q4G151
Gene ID:
Mouse(244745) dpy-19-like 1 (C. elegans)
Rat(315496) dpy-19-like 1 (C. elegans)
chicken(420743) dpy-19-like 1 (C. elegans)
domestic cat(101096461) dpy-19-like 1 (C. elegans)
cow(536508) dpy-19-like 1 (C. elegans)
dog(482395) dpy-19-like 1 (C. elegans)
naked mole-rat(101697021) dpy-19-like 1 (C. elegans)
domestic guinea pig(100727671) dpy-19-like 1 (C. elegans)
sheep(101109090) dpy-19-like 1 (C. elegans)
Domestic Rabbit(100340917) dpy-19-like 1 (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015283 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015283 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015283 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172920 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172920 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172920 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_374422 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_374422 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_374422 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015283 Rosetta Predictions human pricing
XM_371891 Rosetta Predictions human pricing
XM_001053132 Rosetta Predictions rat pricing
XM_235970 Rosetta Predictions rat pricing
NM_172920 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015283 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347457 predicted 1909
2 SASI_Hs02_00347458 predicted 244
3 SASI_Hs02_00347459 predicted 2076
4 SASI_Hs02_00347460 predicted 2102
5 SASI_Hs02_00347461 predicted 2029
6 SASI_Hs02_00347462 predicted 2225
7 SASI_Hs02_00347463 predicted 1066
8 SASI_Hs02_00347464 predicted 1986
9 SASI_Hs02_00347465 predicted 1939
10 SASI_Hs02_00347466 predicted 1785
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00252127 predicted 857
2 SASI_Hs01_00252128 predicted 1884
3 SASI_Hs01_00252129 predicted 818
4 SASI_Hs01_00252130 predicted 905
5 SASI_Hs01_00252131 predicted 769
6 SASI_Hs01_00252132 predicted 762
7 SASI_Hs01_00252133 predicted 1282
8 SASI_Hs01_00252134 predicted 2024
9 SASI_Hs01_00252135 predicted 2227
10 SASI_Hs01_00252136 predicted 2352
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053132 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00271342 predicted 1319
2 SASI_Rn02_00271343 predicted 2294
3 SASI_Rn02_00271344 predicted 2171
4 SASI_Rn02_00271345 predicted 1815
5 SASI_Rn02_00271346 predicted 1072
6 SASI_Rn02_00271347 predicted 1372
7 SASI_Rn02_00271348 predicted 995
8 SASI_Rn02_00271349 predicted 2059
9 SASI_Rn02_00271350 predicted 1476
10 SASI_Rn02_00271351 predicted 720
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235970 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389785 predicted 1323
2 SASI_Rn02_00389786 predicted 2302
3 SASI_Rn02_00389787 predicted 2170
4 SASI_Rn02_00389788 predicted 1823
5 SASI_Rn02_00389789 predicted 1078
6 SASI_Rn02_00389790 predicted 1375
7 SASI_Rn02_00389791 predicted 990
8 SASI_Rn02_00389792 predicted 2064
9 SASI_Rn02_00389793 predicted 1483
10 SASI_Rn02_00389794 predicted 724
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172920 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084685 predicted 1834
2 SASI_Mm01_00084686 predicted 1232
3 SASI_Mm01_00084687 predicted 820
4 SASI_Mm01_00084688 predicted 725
5 SASI_Mm01_00084689 predicted 726
6 SASI_Mm01_00084690 predicted 2336
7 SASI_Mm02_00344921 predicted 465
8 SASI_Mm01_00084691 predicted 1319
9 SASI_Mm01_00084692 predicted 1134
10 SASI_Mm01_00084693 predicted 2337
11 SASI_Mm01_00084694 predicted 1667
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015283
DPY19L1 MISSION shRNA Bacterial Glycerol Stock
dpy-19-like 1 (C. elegans)
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000436230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015283.1-240s21c1
Sequence:CCGGTGTTGCACTGGAGCCATATAACTCGAGTTATATGGCTCCAGTGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015283.1-513s21c1
Sequence:CCGGTAATGGACTTGATTGGTATTCCTCGAGGAATACCAATCAAGTCCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015283.1-1234s21c1
Sequence:CCGGTATTGCAGATGACGCTCATATCTCGAGATATGAGCGTCATCTGCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015283.1-1311s21c1
Sequence:CCGGATACCTGTGCAGCGGAGTTTGCTCGAGCAAACTCCGCTGCACAGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015283
DPY19L1 MISSION shRNA shRNA Plasmid DNA
dpy-19-like 1 (C. elegans)
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000436230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015283.1-240s21c1
Sequence:CCGGTGTTGCACTGGAGCCATATAACTCGAGTTATATGGCTCCAGTGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015283.1-513s21c1
Sequence:CCGGTAATGGACTTGATTGGTATTCCTCGAGGAATACCAATCAAGTCCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015283.1-1234s21c1
Sequence:CCGGTATTGCAGATGACGCTCATATCTCGAGATATGAGCGTCATCTGCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015283.1-1311s21c1
Sequence:CCGGATACCTGTGCAGCGGAGTTTGCTCGAGCAAACTCCGCTGCACAGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015283
DPY19L1 MISSION shRNA Lentiviral Transduction Particles
dpy-19-like 1 (C. elegans)
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000436230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015283.1-240s21c1
Sequence:CCGGTGTTGCACTGGAGCCATATAACTCGAGTTATATGGCTCCAGTGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015283.1-513s21c1
Sequence:CCGGTAATGGACTTGATTGGTATTCCTCGAGGAATACCAATCAAGTCCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015283.1-1234s21c1
Sequence:CCGGTATTGCAGATGACGCTCATATCTCGAGATATGAGCGTCATCTGCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015283.1-1311s21c1
Sequence:CCGGATACCTGTGCAGCGGAGTTTGCTCGAGCAAACTCCGCTGCACAGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172920
VALIDATED
DPY19L1 MISSION shRNA Bacterial Glycerol Stock
dpy-19-like 1 (C. elegans)
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172920.4-2404s21c1
Sequence:CCGGTACATCAGATCGATTAGTTACCTCGAGGTAACTAATCGATCTGATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172920.4-1161s1c1
Sequence:CCGGCATCGTCTTTGGTAATTATTTCTCGAGAAATAATTACCAAAGACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217656    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172920.4-2400s1c1
Sequence:CCGGGGCTTACATCAGATCGATTAGCTCGAGCTAATCGATCTGATGTAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172920.4-426s21c1
Sequence:CCGGACTCTTACTTCAAGACTATTGCTCGAGCAATAGTCTTGAAGTAAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172920.4-893s21c1
Sequence:CCGGATGTTGCTTGTGACCCATATTCTCGAGAATATGGGTCACAAGCAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172920.4-1010s21c1
Sequence:CCGGCTTACTCAGATTGCATCATTACTCGAGTAATGATGCAATCTGAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172920.4-1158s21c1
Sequence:CCGGATGCATCGTCTTTGGTAATTACTCGAGTAATTACCAAAGACGATGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172920.4-2265s21c1
Sequence:CCGGTGCCAGAGACGCACCAGTAATCTCGAGATTACTGGTGCGTCTCTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172920.1-1001s1c1
Sequence:CCGGCAGGTCTAAGAGCCAGAACAACTCGAGTTGTTCTGGCTCTTAGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172920.1-973s1c1
Sequence:CCGGGTGGTGAACCACCCACATTATCTCGAGATAATGTGGGTGGTTCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172920.1-1230s1c1
Sequence:CCGGGCCTCACTTTACCACAGTGTTCTCGAGAACACTGTGGTAAAGTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_172920.1-1205s1c1
Sequence:CCGGGCAACATCTTGGTGAAGGATTCTCGAGAATCCTTCACCAAGATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_172920.1-3119s1c1
Sequence:CCGGCCTCTAACAATTCCCTTCATACTCGAGTATGAAGGGAATTGTTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_172920.1-866s1c1
Sequence:CCGGCACAAGAAGAACTCATAGAATCTCGAGATTCTATGAGTTCTTCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_172920.1-772s1c1
Sequence:CCGGGCTGTTGTCTTTGCTATATTACTCGAGTAATATAGCAAAGACAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172920
VALIDATED
DPY19L1 MISSION shRNA shRNA Plasmid DNA
dpy-19-like 1 (C. elegans)
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172920.4-2404s21c1
Sequence:CCGGTACATCAGATCGATTAGTTACCTCGAGGTAACTAATCGATCTGATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172920.4-1161s1c1
Sequence:CCGGCATCGTCTTTGGTAATTATTTCTCGAGAAATAATTACCAAAGACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217656    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172920.4-2400s1c1
Sequence:CCGGGGCTTACATCAGATCGATTAGCTCGAGCTAATCGATCTGATGTAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172920.4-426s21c1
Sequence:CCGGACTCTTACTTCAAGACTATTGCTCGAGCAATAGTCTTGAAGTAAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172920.4-893s21c1
Sequence:CCGGATGTTGCTTGTGACCCATATTCTCGAGAATATGGGTCACAAGCAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172920.4-1010s21c1
Sequence:CCGGCTTACTCAGATTGCATCATTACTCGAGTAATGATGCAATCTGAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172920.4-1158s21c1
Sequence:CCGGATGCATCGTCTTTGGTAATTACTCGAGTAATTACCAAAGACGATGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172920.4-2265s21c1
Sequence:CCGGTGCCAGAGACGCACCAGTAATCTCGAGATTACTGGTGCGTCTCTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172920.1-1001s1c1
Sequence:CCGGCAGGTCTAAGAGCCAGAACAACTCGAGTTGTTCTGGCTCTTAGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172920.1-973s1c1
Sequence:CCGGGTGGTGAACCACCCACATTATCTCGAGATAATGTGGGTGGTTCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172920.1-1230s1c1
Sequence:CCGGGCCTCACTTTACCACAGTGTTCTCGAGAACACTGTGGTAAAGTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_172920.1-1205s1c1
Sequence:CCGGGCAACATCTTGGTGAAGGATTCTCGAGAATCCTTCACCAAGATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_172920.1-3119s1c1
Sequence:CCGGCCTCTAACAATTCCCTTCATACTCGAGTATGAAGGGAATTGTTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_172920.1-866s1c1
Sequence:CCGGCACAAGAAGAACTCATAGAATCTCGAGATTCTATGAGTTCTTCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_172920.1-772s1c1
Sequence:CCGGGCTGTTGTCTTTGCTATATTACTCGAGTAATATAGCAAAGACAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172920
VALIDATED
DPY19L1 MISSION shRNA Lentiviral Transduction Particles
dpy-19-like 1 (C. elegans)
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172920.4-2404s21c1
Sequence:CCGGTACATCAGATCGATTAGTTACCTCGAGGTAACTAATCGATCTGATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172920.4-1161s1c1
Sequence:CCGGCATCGTCTTTGGTAATTATTTCTCGAGAAATAATTACCAAAGACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217656    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172920.4-2400s1c1
Sequence:CCGGGGCTTACATCAGATCGATTAGCTCGAGCTAATCGATCTGATGTAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172920.4-426s21c1
Sequence:CCGGACTCTTACTTCAAGACTATTGCTCGAGCAATAGTCTTGAAGTAAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172920.4-893s21c1
Sequence:CCGGATGTTGCTTGTGACCCATATTCTCGAGAATATGGGTCACAAGCAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172920.4-1010s21c1
Sequence:CCGGCTTACTCAGATTGCATCATTACTCGAGTAATGATGCAATCTGAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172920.4-1158s21c1
Sequence:CCGGATGCATCGTCTTTGGTAATTACTCGAGTAATTACCAAAGACGATGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172920.4-2265s21c1
Sequence:CCGGTGCCAGAGACGCACCAGTAATCTCGAGATTACTGGTGCGTCTCTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172920.1-1001s1c1
Sequence:CCGGCAGGTCTAAGAGCCAGAACAACTCGAGTTGTTCTGGCTCTTAGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172920.1-973s1c1
Sequence:CCGGGTGGTGAACCACCCACATTATCTCGAGATAATGTGGGTGGTTCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172920.1-1230s1c1
Sequence:CCGGGCCTCACTTTACCACAGTGTTCTCGAGAACACTGTGGTAAAGTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_172920.1-1205s1c1
Sequence:CCGGGCAACATCTTGGTGAAGGATTCTCGAGAATCCTTCACCAAGATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_172920.1-3119s1c1
Sequence:CCGGCCTCTAACAATTCCCTTCATACTCGAGTATGAAGGGAATTGTTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_172920.1-866s1c1
Sequence:CCGGCACAAGAAGAACTCATAGAATCTCGAGATTCTATGAGTTCTTCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_172920.1-772s1c1
Sequence:CCGGGCTGTTGTCTTTGCTATATTACTCGAGTAATATAGCAAAGACAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_374422
VALIDATED
DPY19L1 MISSION shRNA Bacterial Glycerol Stock
dpy-19-like 1 (C. elegans)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:XM_374422.1-1712s1c1
Sequence:CCGGCCCAAGAAGAACTTATAGAATCTCGAGATTCTATAAGTTCTTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000185485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:XM_374422.1-1626s1c1
Sequence:CCGGGTTTGCTATATTAGCAGCAATCTCGAGATTGCTGCTAATATAGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_374422.1-102s1c1
Sequence:CCGGCACTAGATATGCTGGGAAGAACTCGAGTTCTTCCCAGCATATCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000185907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:XM_374422.1-1014s1c1
Sequence:CCGGGTTTGGGAACTCAATGTTATTCTCGAGAATAACATTGAGTTCCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_374422.1-769s1c1
Sequence:CCGGCTTGTTCTTCAGATGTTGCTACTCGAGTAGCAACATCTGAAGAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_374422
VALIDATED
DPY19L1 MISSION shRNA shRNA Plasmid DNA
dpy-19-like 1 (C. elegans)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:XM_374422.1-1712s1c1
Sequence:CCGGCCCAAGAAGAACTTATAGAATCTCGAGATTCTATAAGTTCTTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000185485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:XM_374422.1-1626s1c1
Sequence:CCGGGTTTGCTATATTAGCAGCAATCTCGAGATTGCTGCTAATATAGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_374422.1-102s1c1
Sequence:CCGGCACTAGATATGCTGGGAAGAACTCGAGTTCTTCCCAGCATATCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000185907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:XM_374422.1-1014s1c1
Sequence:CCGGGTTTGGGAACTCAATGTTATTCTCGAGAATAACATTGAGTTCCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_374422.1-769s1c1
Sequence:CCGGCTTGTTCTTCAGATGTTGCTACTCGAGTAGCAACATCTGAAGAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_374422
VALIDATED
DPY19L1 MISSION shRNA Lentiviral Transduction Particles
dpy-19-like 1 (C. elegans)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:XM_374422.1-1712s1c1
Sequence:CCGGCCCAAGAAGAACTTATAGAATCTCGAGATTCTATAAGTTCTTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000185485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:XM_374422.1-1626s1c1
Sequence:CCGGGTTTGCTATATTAGCAGCAATCTCGAGATTGCTGCTAATATAGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_374422.1-102s1c1
Sequence:CCGGCACTAGATATGCTGGGAAGAACTCGAGTTCTTCCCAGCATATCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000185907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:XM_374422.1-1014s1c1
Sequence:CCGGGTTTGGGAACTCAATGTTATTCTCGAGAATAACATTGAGTTCCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_374422.1-769s1c1
Sequence:CCGGCTTGTTCTTCAGATGTTGCTACTCGAGTAGCAACATCTGAAGAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks