EMAIL THIS PAGE TO A FRIEND

DPY19L2

dpy-19-like 2 (C. elegans)

67 Gene Product Result for
Synonyms: SPATA34 SPGF9
UniProtKB ID: Q6NUT2, A4FVC1, Q3ZCX2, Q6UWG8, Q96LZ9
Gene ID:
Human(283417) Summary: The protein encoded by this gene belongs to the dpy-19 family. It is highly expressed in testis, and is required for sperm head elongation and acrosome formation during spermatogenesis. Mutations in this gene are associated with an infertility disorder, spermatogenic failure type 9 (SPGF9). [provided by RefSeq, Dec 2011]
Mouse(320752) dpy-19-like 2 (C. elegans)
Rat(300461) dpy-19-like 2 (C. elegans)
dog(475282) dpy-19-like 2 (C. elegans)
domestic cat(101096714) dpy-19-like 2 (C. elegans)
sheep(101117923) dpy-19-like 2 (C. elegans)
naked mole-rat(101697194) dpy-19-like 2 (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173812 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173812 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173812 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU112901 MISSION® esiRNA esiRNA human DPY19L2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173812 Rosetta Predictions human pricing
XM_235972 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173812 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103671 predicted 2475
2 SASI_Hs01_00103672 predicted 721
3 SASI_Hs01_00103673 predicted 2479
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235972 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389795 predicted 404
2 SASI_Rn02_00389796 predicted 301
3 SASI_Rn02_00389797 predicted 210
4 SASI_Rn02_00389798 predicted 205
5 SASI_Rn02_00389799 predicted 295
6 SASI_Rn02_00389800 predicted 204
7 SASI_Rn02_00389801 predicted 308
8 SASI_Rn02_00389802 predicted 213
9 SASI_Rn02_00389803 predicted 398
10 SASI_Rn02_00389804 predicted 393
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173812
DPY19L2 MISSION shRNA Bacterial Glycerol Stock
dpy-19-like 2 (C. elegans)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173812.3-1568s1c1
Sequence:CCGGCGCTGAGATACACAAAGACATCTCGAGATGTCTTTGTGTATCTCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173812.3-2789s1c1
Sequence:CCGGGCTCTGAAATGACATCCTTAACTCGAGTTAAGGATGTCATTTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173812.3-1569s1c1
Sequence:CCGGGCTGAGATACACAAAGACATTCTCGAGAATGTCTTTGTGTATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173812.3-1917s1c1
Sequence:CCGGCCGTAATCAATGGAGCATAATCTCGAGATTATGCTCCATTGATTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173812.3-1538s1c1
Sequence:CCGGCCGAATTTGACTTCATGGAAACTCGAGTTTCCATGAAGTCAAATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173812.4-2427s21c1
Sequence:CCGGATAGTGTGTACAGAGTATTAACTCGAGTTAATACTCTGTACACACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173812.4-1393s21c1
Sequence:CCGGGACGTGGGCAATAATTCTAAACTCGAGTTTAGAATTATTGCCCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173812.4-2402s21c1
Sequence:CCGGCCTTACTTCACCACAGTATTTCTCGAGAAATACTGTGGTGAAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173812
DPY19L2 MISSION shRNA shRNA Plasmid DNA
dpy-19-like 2 (C. elegans)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173812.3-1568s1c1
Sequence:CCGGCGCTGAGATACACAAAGACATCTCGAGATGTCTTTGTGTATCTCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173812.3-2789s1c1
Sequence:CCGGGCTCTGAAATGACATCCTTAACTCGAGTTAAGGATGTCATTTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173812.3-1569s1c1
Sequence:CCGGGCTGAGATACACAAAGACATTCTCGAGAATGTCTTTGTGTATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173812.3-1917s1c1
Sequence:CCGGCCGTAATCAATGGAGCATAATCTCGAGATTATGCTCCATTGATTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173812.3-1538s1c1
Sequence:CCGGCCGAATTTGACTTCATGGAAACTCGAGTTTCCATGAAGTCAAATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173812.4-2427s21c1
Sequence:CCGGATAGTGTGTACAGAGTATTAACTCGAGTTAATACTCTGTACACACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173812.4-1393s21c1
Sequence:CCGGGACGTGGGCAATAATTCTAAACTCGAGTTTAGAATTATTGCCCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173812.4-2402s21c1
Sequence:CCGGCCTTACTTCACCACAGTATTTCTCGAGAAATACTGTGGTGAAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173812
DPY19L2 MISSION shRNA Lentiviral Transduction Particles
dpy-19-like 2 (C. elegans)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173812.3-1568s1c1
Sequence:CCGGCGCTGAGATACACAAAGACATCTCGAGATGTCTTTGTGTATCTCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173812.3-2789s1c1
Sequence:CCGGGCTCTGAAATGACATCCTTAACTCGAGTTAAGGATGTCATTTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173812.3-1569s1c1
Sequence:CCGGGCTGAGATACACAAAGACATTCTCGAGAATGTCTTTGTGTATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173812.3-1917s1c1
Sequence:CCGGCCGTAATCAATGGAGCATAATCTCGAGATTATGCTCCATTGATTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173812.3-1538s1c1
Sequence:CCGGCCGAATTTGACTTCATGGAAACTCGAGTTTCCATGAAGTCAAATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173812.4-2427s21c1
Sequence:CCGGATAGTGTGTACAGAGTATTAACTCGAGTTAATACTCTGTACACACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173812.4-1393s21c1
Sequence:CCGGGACGTGGGCAATAATTCTAAACTCGAGTTTAGAATTATTGCCCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173812.4-2402s21c1
Sequence:CCGGCCTTACTTCACCACAGTATTTCTCGAGAAATACTGTGGTGAAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks