EMAIL THIS PAGE TO A FRIEND

DPY19L2P2

DPY19L2 pseudogene 2

31 Gene Product Result for
Species: Human DPY19L2P2(349152)
UniProtKB ID: Q6ZN68, Q8N9V4, Q8ND62
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182634 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182634 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182634 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU149291 MISSION® esiRNA esiRNA human DPY19L2P2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182634 Rosetta Predictions human pricing
NR_003561 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182634 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157961 predicted 2500
2 SASI_Hs01_00157962 predicted 3057
3 SASI_Hs01_00157963 predicted 3269
4 SASI_Hs01_00157964 predicted 2492
5 SASI_Hs01_00157965 predicted 3280
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003561 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379534 predicted 2401
2 SASI_Hs02_00379535 predicted 2963
3 SASI_Hs02_00379536 predicted 428
4 SASI_Hs02_00379537 predicted 26
5 SASI_Hs02_00379538 predicted 3182
6 SASI_Hs02_00379539 predicted 2399
7 SASI_Hs02_00379540 predicted 154
8 SASI_Hs02_00379541 predicted 442
9 SASI_Hs02_00379542 predicted 3180
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182634
DPY19L2P2 MISSION shRNA Bacterial Glycerol Stock
DPY19L2 pseudogene 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182634.1-683s1c1
Sequence:CCGGCCCGAATTTGACTTCATGGAACTCGAGTTCCATGAAGTCAAATTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182634.1-1060s1c1
Sequence:CCGGCCTCTGTAATCAATGGAGCATCTCGAGATGCTCCATTGATTACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167252    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182634.1-1209s1c1
Sequence:CCGGCCATTGTGAATCATCCACATTCTCGAGAATGTGGATGATTCACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182634.1-865s1c1
Sequence:CCGGCACATTGCAGTTGTTAGCATTCTCGAGAATGCTAACAACTGCAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182634.1-937s1c1
Sequence:CCGGCATGTGTGTTATGGCTTCCTTCTCGAGAAGGAAGCCATAACACACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182634
DPY19L2P2 MISSION shRNA shRNA Plasmid DNA
DPY19L2 pseudogene 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182634.1-683s1c1
Sequence:CCGGCCCGAATTTGACTTCATGGAACTCGAGTTCCATGAAGTCAAATTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182634.1-1060s1c1
Sequence:CCGGCCTCTGTAATCAATGGAGCATCTCGAGATGCTCCATTGATTACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167252    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182634.1-1209s1c1
Sequence:CCGGCCATTGTGAATCATCCACATTCTCGAGAATGTGGATGATTCACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182634.1-865s1c1
Sequence:CCGGCACATTGCAGTTGTTAGCATTCTCGAGAATGCTAACAACTGCAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182634.1-937s1c1
Sequence:CCGGCATGTGTGTTATGGCTTCCTTCTCGAGAAGGAAGCCATAACACACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182634
DPY19L2P2 MISSION shRNA Lentiviral Transduction Particles
DPY19L2 pseudogene 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182634.1-683s1c1
Sequence:CCGGCCCGAATTTGACTTCATGGAACTCGAGTTCCATGAAGTCAAATTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182634.1-1060s1c1
Sequence:CCGGCCTCTGTAATCAATGGAGCATCTCGAGATGCTCCATTGATTACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167252    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182634.1-1209s1c1
Sequence:CCGGCCATTGTGAATCATCCACATTCTCGAGAATGTGGATGATTCACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182634.1-865s1c1
Sequence:CCGGCACATTGCAGTTGTTAGCATTCTCGAGAATGCTAACAACTGCAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182634.1-937s1c1
Sequence:CCGGCATGTGTGTTATGGCTTCCTTCTCGAGAAGGAAGCCATAACACACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks