EMAIL THIS PAGE TO A FRIEND

DPY19L3

dpy-19-like 3 (C. elegans)

178 Gene Product Result for
UniProtKB ID: Q6ZPD9, Q68DC7, Q6ZTB7, Q6ZTS2
Gene ID:
Mouse(233115) dpy-19-like 3 (C. elegans)
Rat(308519) dpy-19-like 3 (C. elegans)
Zebrafish(796987) dpy-19-like 3 (C. elegans)
chicken(768782) dpy-19-like 3 (C. elegans)
cow(521976) dpy-19-like 3 (C. elegans)
Horse(100055362) dpy-19-like 3 (C. elegans)
domestic cat(101092812) dpy-19-like 3 (C. elegans)
dog(611998) dpy-19-like 3 (C. elegans)
naked mole-rat(101715650) dpy-19-like 3 (C. elegans)
domestic guinea pig(100716980) dpy-19-like 3 (C. elegans)
sheep(101107888) dpy-19-like 3 (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207325 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207325 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207325 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178704 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178704 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178704 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU088231 MISSION® esiRNA esiRNA human DPY19L3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207325 Rosetta Predictions human pricing
XM_001079819 Rosetta Predictions rat pricing
XM_218514 Rosetta Predictions rat pricing
NM_178704 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117108 predicted 1593
2 SASI_Hs01_00117109 predicted 800
3 SASI_Hs01_00117110 predicted 1762
4 SASI_Hs02_00373868 predicted 1627
5 SASI_Hs01_00117112 predicted 393
6 SASI_Hs01_00117113 predicted 2416
7 SASI_Hs01_00117114 predicted 754
8 SASI_Hs01_00117115 predicted 1736
9 SASI_Hs02_00373869 predicted 1805
10 SASI_Hs01_00117116 predicted 2359
11 SASI_Hs01_00117111 predicted 1784
12 SASI_Hs01_00117117 predicted 385
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079819 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00365598 predicted 1483
2 SASI_Rn02_00365599 predicted 1185
3 SASI_Rn02_00365600 predicted 505
4 SASI_Rn02_00365601 predicted 600
5 SASI_Rn02_00365602 predicted 1908
6 SASI_Rn02_00365603 predicted 959
7 SASI_Rn02_00365604 predicted 567
8 SASI_Rn02_00365605 predicted 1225
9 SASI_Rn02_00365606 predicted 731
10 SASI_Rn02_00365607 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218514 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377831 predicted 1483
2 SASI_Rn02_00377832 predicted 1185
3 SASI_Rn02_00377833 predicted 496
4 SASI_Rn02_00377834 predicted 600
5 SASI_Rn02_00377835 predicted 1904
6 SASI_Rn02_00377836 predicted 958
7 SASI_Rn02_00377837 predicted 567
8 SASI_Rn02_00377838 predicted 1229
9 SASI_Rn02_00377839 predicted 735
10 SASI_Rn02_00377840 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178704 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126897 predicted 519
2 SASI_Mm02_00349204 predicted 568
3 SASI_Mm02_00349205 predicted 559
4 SASI_Mm01_00126899 predicted 1835
5 SASI_Mm01_00126900 predicted 443
6 SASI_Mm01_00126901 predicted 1535
7 SASI_Mm01_00126903 predicted 683
8 SASI_Mm01_00126904 predicted 1618
9 SASI_Mm01_00126905 predicted 1720
10 SASI_Mm01_00126906 predicted 1186
11 SASI_Mm01_00126898 predicted 1213
12 SASI_Mm01_00126902 predicted 1110
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207325
VALIDATED
DPY19L3 MISSION shRNA Bacterial Glycerol Stock
dpy-19-like 3 (C. elegans)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_207325.1-2038s1c1
Sequence:CCGGCCAGAGCGGTTTATCAGATATCTCGAGATATCTGATAAACCGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207325.1-3859s1c1
Sequence:CCGGGCAACTGAAACTCCTGAATTACTCGAGTAATTCAGGAGTTTCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207325.1-491s1c1
Sequence:CCGGCCTGTATTACTCCTACTACAACTCGAGTTGTAGTAGGAGTAATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134317    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_207325.1-2700s1c1
Sequence:CCGGGCTCAGGATTTGAAATACGTTCTCGAGAACGTATTTCAAATCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_207325.1-1509s1c1
Sequence:CCGGGCATTCGTTGTTGCCTTTCATCTCGAGATGAAAGGCAACAACGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207325
VALIDATED
DPY19L3 MISSION shRNA shRNA Plasmid DNA
dpy-19-like 3 (C. elegans)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_207325.1-2038s1c1
Sequence:CCGGCCAGAGCGGTTTATCAGATATCTCGAGATATCTGATAAACCGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207325.1-3859s1c1
Sequence:CCGGGCAACTGAAACTCCTGAATTACTCGAGTAATTCAGGAGTTTCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207325.1-491s1c1
Sequence:CCGGCCTGTATTACTCCTACTACAACTCGAGTTGTAGTAGGAGTAATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134317    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_207325.1-2700s1c1
Sequence:CCGGGCTCAGGATTTGAAATACGTTCTCGAGAACGTATTTCAAATCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_207325.1-1509s1c1
Sequence:CCGGGCATTCGTTGTTGCCTTTCATCTCGAGATGAAAGGCAACAACGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207325
VALIDATED
DPY19L3 MISSION shRNA Lentiviral Transduction Particles
dpy-19-like 3 (C. elegans)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_207325.1-2038s1c1
Sequence:CCGGCCAGAGCGGTTTATCAGATATCTCGAGATATCTGATAAACCGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207325.1-3859s1c1
Sequence:CCGGGCAACTGAAACTCCTGAATTACTCGAGTAATTCAGGAGTTTCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207325.1-491s1c1
Sequence:CCGGCCTGTATTACTCCTACTACAACTCGAGTTGTAGTAGGAGTAATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134317    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_207325.1-2700s1c1
Sequence:CCGGGCTCAGGATTTGAAATACGTTCTCGAGAACGTATTTCAAATCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_207325.1-1509s1c1
Sequence:CCGGGCATTCGTTGTTGCCTTTCATCTCGAGATGAAAGGCAACAACGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178704
DPY19L3 MISSION shRNA Bacterial Glycerol Stock
dpy-19-like 3 (C. elegans)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127264    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178704.2-4020s1c1
Sequence:CCGGCGTGCATTCATCTAATCACTTCTCGAGAAGTGATTAGATGAATGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178704.2-2227s1c1
Sequence:CCGGCGCTTCTGTGAAGAGATTAAACTCGAGTTTAATCTCTTCACAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178704.2-1478s1c1
Sequence:CCGGCATCCGTTGTAGCCTTTCATACTCGAGTATGAAAGGCTACAACGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178704.2-1581s1c1
Sequence:CCGGCCTGATCCATACCATTCTGTTCTCGAGAACAGAATGGTATGGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178704.2-574s1c1
Sequence:CCGGCGGATGAACATTTACCAAGAACTCGAGTTCTTGGTAAATGTTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178704
DPY19L3 MISSION shRNA shRNA Plasmid DNA
dpy-19-like 3 (C. elegans)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127264    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178704.2-4020s1c1
Sequence:CCGGCGTGCATTCATCTAATCACTTCTCGAGAAGTGATTAGATGAATGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178704.2-2227s1c1
Sequence:CCGGCGCTTCTGTGAAGAGATTAAACTCGAGTTTAATCTCTTCACAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178704.2-1478s1c1
Sequence:CCGGCATCCGTTGTAGCCTTTCATACTCGAGTATGAAAGGCTACAACGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178704.2-1581s1c1
Sequence:CCGGCCTGATCCATACCATTCTGTTCTCGAGAACAGAATGGTATGGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178704.2-574s1c1
Sequence:CCGGCGGATGAACATTTACCAAGAACTCGAGTTCTTGGTAAATGTTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178704
DPY19L3 MISSION shRNA Lentiviral Transduction Particles
dpy-19-like 3 (C. elegans)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127264    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178704.2-4020s1c1
Sequence:CCGGCGTGCATTCATCTAATCACTTCTCGAGAAGTGATTAGATGAATGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178704.2-2227s1c1
Sequence:CCGGCGCTTCTGTGAAGAGATTAAACTCGAGTTTAATCTCTTCACAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178704.2-1478s1c1
Sequence:CCGGCATCCGTTGTAGCCTTTCATACTCGAGTATGAAAGGCTACAACGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178704.2-1581s1c1
Sequence:CCGGCCTGATCCATACCATTCTGTTCTCGAGAACAGAATGGTATGGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178704.2-574s1c1
Sequence:CCGGCGGATGAACATTTACCAAGAACTCGAGTTCTTGGTAAATGTTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks