EMAIL THIS PAGE TO A FRIEND

DPY19L4

dpy-19-like 4 (C. elegans)

127 Gene Product Result for
UniProtKB ID: Q7Z388, Q6ZW32, Q6ZW42, Q7Z329
Gene ID:
Mouse(381510) dpy-19-like 4 (C. elegans)
Rat(297824) dpy-19-like 4 (C. elegans)
sheep(101110069) dpy-19-like 4 (C. elegans)
domestic guinea pig(100733007) dpy-19-like 4 (C. elegans)
naked mole-rat(101701132) dpy-19-like 4 (C. elegans)
chicken(420229) dpy-19-like 4 (C. elegans)
domestic cat(101089835) dpy-19-like 4 (C. elegans)
cow(531435) dpy-19-like 4 (C. elegans)
Horse(100058629) dpy-19-like 4 (C. elegans)
dog(611671) dpy-19-like 4 (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181787 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181787 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181787 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081201 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081201 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081201 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181787 Rosetta Predictions human pricing
XM_001072543 Rosetta Predictions rat pricing
XM_216331 Rosetta Predictions rat pricing
NM_001081201 Rosetta Predictions mouse pricing
XM_355469 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181787 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015697 predicted 721
2 SASI_Hs01_00015699 predicted 1971
3 SASI_Hs01_00015700 predicted 1444
4 SASI_Hs02_00370390 predicted 731
5 SASI_Hs01_00015701 predicted 322
6 SASI_Hs01_00015702 predicted 1094
7 SASI_Hs01_00015703 predicted 2030
8 SASI_Hs02_00370391 predicted 2212
9 SASI_Hs01_00015704 predicted 1914
10 SASI_Hs02_00370392 predicted 1671
11 SASI_Hs01_00015698 predicted 2223
12 SASI_Hs01_00015705 predicted 1737
13 SASI_Hs01_00015706 predicted 548
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072543 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00339627 predicted 2047
2 SASI_Rn02_00339628 predicted 2467
3 SASI_Rn02_00339629 predicted 1992
4 SASI_Rn02_00339630 predicted 851
5 SASI_Rn02_00339631 predicted 2354
6 SASI_Rn02_00339632 predicted 2176
7 SASI_Rn02_00339633 predicted 2293
8 SASI_Rn02_00339634 predicted 725
9 SASI_Rn02_00339635 predicted 1901
10 SASI_Rn02_00339636 predicted 2479
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216331 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376510 predicted 2041
2 SASI_Rn02_00376511 predicted 1993
3 SASI_Rn02_00376512 predicted 682
4 SASI_Rn02_00376513 predicted 851
5 SASI_Rn02_00376514 predicted 971
6 SASI_Rn02_00376515 predicted 778
7 SASI_Rn02_00376516 predicted 727
8 SASI_Rn02_00376517 predicted 1313
9 SASI_Rn02_00376518 predicted 1901
10 SASI_Rn02_00376519 predicted 812
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081201 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296181 predicted 1768
2 SASI_Mm02_00296182 predicted 2259
3 SASI_Mm02_00296183 predicted 2301
4 SASI_Mm02_00296184 predicted 1706
5 SASI_Mm02_00296185 predicted 499
6 SASI_Mm02_00296186 predicted 2189
7 SASI_Mm02_00296187 predicted 314
8 SASI_Mm02_00296188 predicted 1626
9 SASI_Mm02_00296189 predicted 1959
10 SASI_Mm02_00296190 predicted 2197
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355469 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00220502 predicted 1778
2 SASI_Mm01_00220503 predicted 462
3 SASI_Mm01_00220504 predicted 324
4 SASI_Mm01_00220505 predicted 2267
5 SASI_Mm01_00220506 predicted 2024
6 SASI_Mm01_00220507 predicted 2306
7 SASI_Mm01_00220508 predicted 1716
8 SASI_Mm01_00220509 predicted 2200
9 SASI_Mm01_00220510 predicted 1632
10 SASI_Mm01_00220511 predicted 2088
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181787
DPY19L4 MISSION shRNA Bacterial Glycerol Stock
dpy-19-like 4 (C. elegans)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181787.1-361s1c1
Sequence:CCGGCAGTGCCATTTATTACTCCTACTCGAGTAGGAGTAATAAATGGCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181787.1-1589s1c1
Sequence:CCGGCCCGAACTTTGGATGACACTTCTCGAGAAGTGTCATCCAAAGTTCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181787.1-497s1c1
Sequence:CCGGCCGGAACTTATTGCTAGCATTCTCGAGAATGCTAGCAATAAGTTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181787.1-1318s1c1
Sequence:CCGGGCGATTGACACAGTCTTCTTTCTCGAGAAAGAAGACTGTGTCAATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181787.1-1830s1c1
Sequence:CCGGCACAGTTAATGGGTGCGATTACTCGAGTAATCGCACCCATTAACTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181787.1-765s1c1
Sequence:CCGGCTGCACTTACAGGCTATTTAACTCGAGTTAAATAGCCTGTAAGTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181787.1-1844s1c1
Sequence:CCGGGCGATTAAATTATGCACTGGACTCGAGTCCAGTGCATAATTTAATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181787.1-542s1c1
Sequence:CCGGGAGATTATTGAGCCAGTGTATCTCGAGATACACTGGCTCAATAATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144763    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181787.1-2733s1c1
Sequence:CCGGGCTGAAGATATGTGGCATTTACTCGAGTAAATGCCACATATCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181787.1-498s1c1
Sequence:CCGGCGGAACTTATTGCTAGCATTTCTCGAGAAATGCTAGCAATAAGTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144321    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181787.1-2837s1c1
Sequence:CCGGCCTCATCTACTGCTTATGTTACTCGAGTAACATAAGCAGTAGATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181787
DPY19L4 MISSION shRNA shRNA Plasmid DNA
dpy-19-like 4 (C. elegans)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181787.1-361s1c1
Sequence:CCGGCAGTGCCATTTATTACTCCTACTCGAGTAGGAGTAATAAATGGCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181787.1-1589s1c1
Sequence:CCGGCCCGAACTTTGGATGACACTTCTCGAGAAGTGTCATCCAAAGTTCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181787.1-497s1c1
Sequence:CCGGCCGGAACTTATTGCTAGCATTCTCGAGAATGCTAGCAATAAGTTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181787.1-1318s1c1
Sequence:CCGGGCGATTGACACAGTCTTCTTTCTCGAGAAAGAAGACTGTGTCAATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181787.1-1830s1c1
Sequence:CCGGCACAGTTAATGGGTGCGATTACTCGAGTAATCGCACCCATTAACTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181787.1-765s1c1
Sequence:CCGGCTGCACTTACAGGCTATTTAACTCGAGTTAAATAGCCTGTAAGTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181787.1-1844s1c1
Sequence:CCGGGCGATTAAATTATGCACTGGACTCGAGTCCAGTGCATAATTTAATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181787.1-542s1c1
Sequence:CCGGGAGATTATTGAGCCAGTGTATCTCGAGATACACTGGCTCAATAATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144763    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181787.1-2733s1c1
Sequence:CCGGGCTGAAGATATGTGGCATTTACTCGAGTAAATGCCACATATCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181787.1-498s1c1
Sequence:CCGGCGGAACTTATTGCTAGCATTTCTCGAGAAATGCTAGCAATAAGTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144321    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181787.1-2837s1c1
Sequence:CCGGCCTCATCTACTGCTTATGTTACTCGAGTAACATAAGCAGTAGATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181787
DPY19L4 MISSION shRNA Lentiviral Transduction Particles
dpy-19-like 4 (C. elegans)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181787.1-361s1c1
Sequence:CCGGCAGTGCCATTTATTACTCCTACTCGAGTAGGAGTAATAAATGGCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181787.1-1589s1c1
Sequence:CCGGCCCGAACTTTGGATGACACTTCTCGAGAAGTGTCATCCAAAGTTCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181787.1-497s1c1
Sequence:CCGGCCGGAACTTATTGCTAGCATTCTCGAGAATGCTAGCAATAAGTTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181787.1-1318s1c1
Sequence:CCGGGCGATTGACACAGTCTTCTTTCTCGAGAAAGAAGACTGTGTCAATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181787.1-1830s1c1
Sequence:CCGGCACAGTTAATGGGTGCGATTACTCGAGTAATCGCACCCATTAACTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181787.1-765s1c1
Sequence:CCGGCTGCACTTACAGGCTATTTAACTCGAGTTAAATAGCCTGTAAGTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181787.1-1844s1c1
Sequence:CCGGGCGATTAAATTATGCACTGGACTCGAGTCCAGTGCATAATTTAATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181787.1-542s1c1
Sequence:CCGGGAGATTATTGAGCCAGTGTATCTCGAGATACACTGGCTCAATAATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144763    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181787.1-2733s1c1
Sequence:CCGGGCTGAAGATATGTGGCATTTACTCGAGTAAATGCCACATATCTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181787.1-498s1c1
Sequence:CCGGCGGAACTTATTGCTAGCATTTCTCGAGAAATGCTAGCAATAAGTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144321    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181787.1-2837s1c1
Sequence:CCGGCCTCATCTACTGCTTATGTTACTCGAGTAACATAAGCAGTAGATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081201
VALIDATED
DPY19L4 MISSION shRNA Bacterial Glycerol Stock
dpy-19-like 4 (C. elegans)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081201.1-2524s21c1
Sequence:CCGGCTGTAGCGTCACCTCACAAATCTCGAGATTTGTGAGGTGACGCTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081201.1-326s21c1
Sequence:CCGGAGCTTACCATGAACGGAAATTCTCGAGAATTTCCGTTCATGGTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081201.1-2020s21c1
Sequence:CCGGATAAAGCTAACTACCTAATTGCTCGAGCAATTAGGTAGTTAGCTTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081201.1-1981s21c1
Sequence:CCGGAGCGATCTGCTGAGGATATTTCTCGAGAAATATCCTCAGCAGATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081201.1-2073s21c1
Sequence:CCGGACGAGAGGCTGTCGGGTTAAACTCGAGTTTAACCCGACAGCCTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081201
VALIDATED
DPY19L4 MISSION shRNA shRNA Plasmid DNA
dpy-19-like 4 (C. elegans)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081201.1-2524s21c1
Sequence:CCGGCTGTAGCGTCACCTCACAAATCTCGAGATTTGTGAGGTGACGCTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081201.1-326s21c1
Sequence:CCGGAGCTTACCATGAACGGAAATTCTCGAGAATTTCCGTTCATGGTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081201.1-2020s21c1
Sequence:CCGGATAAAGCTAACTACCTAATTGCTCGAGCAATTAGGTAGTTAGCTTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081201.1-1981s21c1
Sequence:CCGGAGCGATCTGCTGAGGATATTTCTCGAGAAATATCCTCAGCAGATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081201.1-2073s21c1
Sequence:CCGGACGAGAGGCTGTCGGGTTAAACTCGAGTTTAACCCGACAGCCTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081201
VALIDATED
DPY19L4 MISSION shRNA Lentiviral Transduction Particles
dpy-19-like 4 (C. elegans)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081201.1-2524s21c1
Sequence:CCGGCTGTAGCGTCACCTCACAAATCTCGAGATTTGTGAGGTGACGCTACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081201.1-326s21c1
Sequence:CCGGAGCTTACCATGAACGGAAATTCTCGAGAATTTCCGTTCATGGTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081201.1-2020s21c1
Sequence:CCGGATAAAGCTAACTACCTAATTGCTCGAGCAATTAGGTAGTTAGCTTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081201.1-1981s21c1
Sequence:CCGGAGCGATCTGCTGAGGATATTTCTCGAGAAATATCCTCAGCAGATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081201.1-2073s21c1
Sequence:CCGGACGAGAGGCTGTCGGGTTAAACTCGAGTTTAACCCGACAGCCTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)