EMAIL THIS PAGE TO A FRIEND

DPY30

dpy-30 homolog (C. elegans)

53 Gene Product Result for
Synonyms: Cps25 HDPY-30 Saf19
UniProtKB ID: Q9C005, D6W578
Gene ID:
Human(84661) Summary: DPY30 is a component of a Set1-like multiprotein histone methyltransferase complex (Cho et al., 2007 [PubMed 17500065]
Mouse(66310) dpy-30 homolog (C. elegans)
Rat(286897) dpy-30 homolog (C. elegans)
Zebrafish(436711) dpy-30 homolog (C. elegans)
cow(513162) dpy-30 homolog (C. elegans)
chicken(421482) dpy-30 homolog (C. elegans)
domestic cat(101086222) dpy-30 homolog (C. elegans)
dog(475715) dpy-30 homolog (C. elegans)
naked mole-rat(101709570) dpy-30 homolog (C. elegans)
domestic guinea pig(100732217) dpy-30 homolog (C. elegans)
sheep(101105231) dpy-30 homolog (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024428 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024428 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024428 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032574 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032574 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032574 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU075791 MISSION® esiRNA esiRNA human DPY30 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032574 Rosetta Predictions human pricing
NM_173117 Rosetta Predictions rat pricing
NM_024428 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032574 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108213 predicted 265
2 SASI_Hs01_00108214 predicted 236
3 SASI_Hs02_00360092 predicted 267
4 SASI_Hs01_00108216 predicted 573
5 SASI_Hs01_00108217 predicted 576
6 SASI_Hs01_00108218 predicted 269
7 SASI_Hs01_00108220 predicted 241
8 SASI_Hs02_00360093 predicted 279
9 SASI_Hs01_00108222 predicted 563
10 SASI_Hs02_00360094 predicted 262
11 SASI_Hs01_00108215 predicted 515
12 SASI_Hs01_00108219 predicted 460
13 SASI_Hs01_00108221 predicted 463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173117 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121846 predicted 384
2 SASI_Rn01_00121848 predicted 217
3 SASI_Rn01_00121849 predicted 426
4 SASI_Rn01_00121850 predicted 306
5 SASI_Rn01_00121851 predicted 416
6 SASI_Rn01_00121852 predicted 472
7 SASI_Rn01_00121853 predicted 207
8 SASI_Rn01_00121854 predicted 295
9 SASI_Rn01_00121855 predicted 363
10 SASI_Rn02_00269271 predicted 216
11 SASI_Rn01_00121847 predicted 382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024428 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172479 predicted 456
2 SASI_Mm01_00172483 predicted 454
3 SASI_Mm01_00172484 predicted 268
4 SASI_Mm01_00172488 predicted 404
5 SASI_Mm02_00327736 predicted 399
6 SASI_Mm01_00172480 predicted 279
7 SASI_Mm01_00172481 predicted 297
8 SASI_Mm02_00327737 predicted 270
9 SASI_Mm02_00327738 predicted 493
10 SASI_Mm02_00327739 predicted 373
11 SASI_Mm01_00172482 predicted 297
12 SASI_Mm01_00172485 predicted 251
13 SASI_Mm01_00172486 predicted 276
14 SASI_Mm01_00172487 predicted 306
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024428
VALIDATED
DPY30 MISSION shRNA Bacterial Glycerol Stock
dpy-30 homolog (C. elegans)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024428.4-298s21c1
Sequence:CCGGGCGTTGAGAGAATAGTCGAAACTCGAGTTTCGACTATTCTCTCAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024428.4-453s21c1
Sequence:CCGGCCAAATCCCATCGAGTTCCTACTCGAGTAGGAACTCGATGGGATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024428.4-578s21c1
Sequence:CCGGGCAGCTTTAATTGCCATGATTCTCGAGAATCATGGCAATTAAAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024428.4-498s21c1
Sequence:CCGGGCGCAGTTTGAAGATCGAAATCTCGAGATTTCGATCTTCAAACTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024428.2-582s1c1
Sequence:CCGGGCAGCTTTAATTGCCATGATTCTCGAGAATCATGGCAATTAAAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024428.2-457s1c1
Sequence:CCGGCCAAATCCCATCGAGTTCCTACTCGAGTAGGAACTCGATGGGATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024428.2-302s1c1
Sequence:CCGGGCGTTGAGAGAATAGTCGAAACTCGAGTTTCGACTATTCTCTCAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024428.2-502s1c1
Sequence:CCGGGCGCAGTTTGAAGATCGAAATCTCGAGATTTCGATCTTCAAACTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024428.2-412s1c1
Sequence:CCGGCCTATCTTATTACAGGGACTTCTCGAGAAGTCCCTGTAATAAGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024428
VALIDATED
DPY30 MISSION shRNA shRNA Plasmid DNA
dpy-30 homolog (C. elegans)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024428.4-298s21c1
Sequence:CCGGGCGTTGAGAGAATAGTCGAAACTCGAGTTTCGACTATTCTCTCAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024428.4-453s21c1
Sequence:CCGGCCAAATCCCATCGAGTTCCTACTCGAGTAGGAACTCGATGGGATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024428.4-578s21c1
Sequence:CCGGGCAGCTTTAATTGCCATGATTCTCGAGAATCATGGCAATTAAAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024428.4-498s21c1
Sequence:CCGGGCGCAGTTTGAAGATCGAAATCTCGAGATTTCGATCTTCAAACTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024428.2-582s1c1
Sequence:CCGGGCAGCTTTAATTGCCATGATTCTCGAGAATCATGGCAATTAAAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024428.2-457s1c1
Sequence:CCGGCCAAATCCCATCGAGTTCCTACTCGAGTAGGAACTCGATGGGATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024428.2-302s1c1
Sequence:CCGGGCGTTGAGAGAATAGTCGAAACTCGAGTTTCGACTATTCTCTCAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024428.2-502s1c1
Sequence:CCGGGCGCAGTTTGAAGATCGAAATCTCGAGATTTCGATCTTCAAACTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024428.2-412s1c1
Sequence:CCGGCCTATCTTATTACAGGGACTTCTCGAGAAGTCCCTGTAATAAGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024428
VALIDATED
DPY30 MISSION shRNA Lentiviral Transduction Particles
dpy-30 homolog (C. elegans)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024428.4-298s21c1
Sequence:CCGGGCGTTGAGAGAATAGTCGAAACTCGAGTTTCGACTATTCTCTCAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024428.4-453s21c1
Sequence:CCGGCCAAATCCCATCGAGTTCCTACTCGAGTAGGAACTCGATGGGATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024428.4-578s21c1
Sequence:CCGGGCAGCTTTAATTGCCATGATTCTCGAGAATCATGGCAATTAAAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024428.4-498s21c1
Sequence:CCGGGCGCAGTTTGAAGATCGAAATCTCGAGATTTCGATCTTCAAACTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024428.2-582s1c1
Sequence:CCGGGCAGCTTTAATTGCCATGATTCTCGAGAATCATGGCAATTAAAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024428.2-457s1c1
Sequence:CCGGCCAAATCCCATCGAGTTCCTACTCGAGTAGGAACTCGATGGGATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024428.2-302s1c1
Sequence:CCGGGCGTTGAGAGAATAGTCGAAACTCGAGTTTCGACTATTCTCTCAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024428.2-502s1c1
Sequence:CCGGGCGCAGTTTGAAGATCGAAATCTCGAGATTTCGATCTTCAAACTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024428.2-412s1c1
Sequence:CCGGCCTATCTTATTACAGGGACTTCTCGAGAAGTCCCTGTAATAAGATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032574
VALIDATED
DPY30 MISSION shRNA Bacterial Glycerol Stock
dpy-30 homolog (C. elegans)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_032574.2-284s21c1
Sequence:CCGGGTCTCACAGACAACGTTGAGACTCGAGTCTCAACGTTGTCTGTGAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_032574.2-424s21c1
Sequence:CCGGCTTGCTGTGCTTGCAAAGGAACTCGAGTTCCTTTGCAAGCACAGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_032574.2-358s21c1
Sequence:CCGGGATCTCCAGTCTTTGCCAACTCTCGAGAGTTGGCAAAGACTGGAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_032574.2-457s21c1
Sequence:CCGGCCCATTGAATTTCTAGCATCTCTCGAGAGATGCTAGAAATTCAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032574.1-337s1c1
Sequence:CCGGGATCTCCAGTCTTTGCCAACTCTCGAGAGTTGGCAAAGACTGGAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_032574.1-263s1c1
Sequence:CCGGGTCTCACAGACAACGTTGAGACTCGAGTCTCAACGTTGTCTGTGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032574.1-436s1c1
Sequence:CCGGCCCATTGAATTTCTAGCATCTCTCGAGAGATGCTAGAAATTCAATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_032574.1-271s1c1
Sequence:CCGGGACAACGTTGAGAGAATAGTACTCGAGTACTATTCTCTCAACGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_032574.1-403s1c1
Sequence:CCGGCTTGCTGTGCTTGCAAAGGAACTCGAGTTCCTTTGCAAGCACAGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032574.1-273s1c1
Sequence:CCGGCAACGTTGAGAGAATAGTAGACTCGAGTCTACTATTCTCTCAACGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032574
VALIDATED
DPY30 MISSION shRNA shRNA Plasmid DNA
dpy-30 homolog (C. elegans)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_032574.2-284s21c1
Sequence:CCGGGTCTCACAGACAACGTTGAGACTCGAGTCTCAACGTTGTCTGTGAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_032574.2-424s21c1
Sequence:CCGGCTTGCTGTGCTTGCAAAGGAACTCGAGTTCCTTTGCAAGCACAGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_032574.2-358s21c1
Sequence:CCGGGATCTCCAGTCTTTGCCAACTCTCGAGAGTTGGCAAAGACTGGAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_032574.2-457s21c1
Sequence:CCGGCCCATTGAATTTCTAGCATCTCTCGAGAGATGCTAGAAATTCAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032574.1-337s1c1
Sequence:CCGGGATCTCCAGTCTTTGCCAACTCTCGAGAGTTGGCAAAGACTGGAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_032574.1-263s1c1
Sequence:CCGGGTCTCACAGACAACGTTGAGACTCGAGTCTCAACGTTGTCTGTGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032574.1-436s1c1
Sequence:CCGGCCCATTGAATTTCTAGCATCTCTCGAGAGATGCTAGAAATTCAATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_032574.1-271s1c1
Sequence:CCGGGACAACGTTGAGAGAATAGTACTCGAGTACTATTCTCTCAACGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_032574.1-403s1c1
Sequence:CCGGCTTGCTGTGCTTGCAAAGGAACTCGAGTTCCTTTGCAAGCACAGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032574.1-273s1c1
Sequence:CCGGCAACGTTGAGAGAATAGTAGACTCGAGTCTACTATTCTCTCAACGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032574
VALIDATED
DPY30 MISSION shRNA Lentiviral Transduction Particles
dpy-30 homolog (C. elegans)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_032574.2-284s21c1
Sequence:CCGGGTCTCACAGACAACGTTGAGACTCGAGTCTCAACGTTGTCTGTGAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_032574.2-424s21c1
Sequence:CCGGCTTGCTGTGCTTGCAAAGGAACTCGAGTTCCTTTGCAAGCACAGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_032574.2-358s21c1
Sequence:CCGGGATCTCCAGTCTTTGCCAACTCTCGAGAGTTGGCAAAGACTGGAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_032574.2-457s21c1
Sequence:CCGGCCCATTGAATTTCTAGCATCTCTCGAGAGATGCTAGAAATTCAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032574.1-337s1c1
Sequence:CCGGGATCTCCAGTCTTTGCCAACTCTCGAGAGTTGGCAAAGACTGGAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_032574.1-263s1c1
Sequence:CCGGGTCTCACAGACAACGTTGAGACTCGAGTCTCAACGTTGTCTGTGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032574.1-436s1c1
Sequence:CCGGCCCATTGAATTTCTAGCATCTCTCGAGAGATGCTAGAAATTCAATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_032574.1-271s1c1
Sequence:CCGGGACAACGTTGAGAGAATAGTACTCGAGTACTATTCTCTCAACGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_032574.1-403s1c1
Sequence:CCGGCTTGCTGTGCTTGCAAAGGAACTCGAGTTCCTTTGCAAGCACAGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032574.1-273s1c1
Sequence:CCGGCAACGTTGAGAGAATAGTAGACTCGAGTCTACTATTCTCTCAACGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)