EMAIL THIS PAGE TO A FRIEND

DPYD

dihydropyrimidine dehydrogenase

115 Gene Product Result for
Synonyms: DHP DHPDHASE DPD
Gene ID:
Human(1806) Summary: The protein encoded by this gene is a pyrimidine catabolic enzyme and the initial and rate-limiting factor in the pathway of uracil and thymidine catabolism. Mutations in this gene result in dihydropyrimidine dehydrogenase deficiency, an error in pyrimidine metabolism associated with thymine-uraciluria and an increased risk of toxicity in cancer patients receiving 5-fluorouracil chemotherapy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Mouse(99586) dihydropyrimidine dehydrogenase
Rat(81656) dihydropyrimidine dehydrogenase
sheep(101109311) dihydropyrimidine dehydrogenase
domestic guinea pig(100727906) dihydropyrimidine dehydrogenase
naked mole-rat(101704452) dihydropyrimidine dehydrogenase
chicken(429083) dihydropyrimidine dehydrogenase
cow(281124) dihydropyrimidine dehydrogenase
Horse(100057177) dihydropyrimidine dehydrogenase
domestic cat(101084380) dihydropyrimidine dehydrogenase
dog(479935) dihydropyrimidine dehydrogenase
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000110 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000110 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000110 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_170778 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_170778 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_170778 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU060711 MISSION® esiRNA esiRNA human DPYD (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000110 Rosetta Predictions human pricing
NM_031027 Rosetta Predictions rat pricing
NM_170778 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000110 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180538 predicted 603
2 SASI_Hs01_00180539 predicted 1994
3 SASI_Hs01_00180540 predicted 2894
4 SASI_Hs02_00301888 predicted 2849
5 SASI_Hs01_00180543 predicted 3037
6 SASI_Hs01_00180544 predicted 578
7 SASI_Hs01_00180545 predicted 1663
8 SASI_Hs02_00301889 predicted 2441
9 SASI_Hs01_00180546 predicted 500
10 SASI_Hs02_00301890 predicted 886
11 SASI_Hs01_00180537 predicted 1376
12 SASI_Hs01_00180541 predicted 767
13 SASI_Hs01_00180542 predicted 3216
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031027 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054122 predicted 2146
2 SASI_Rn01_00054125 predicted 765
3 SASI_Rn01_00054126 predicted 2348
4 SASI_Rn01_00054127 predicted 401
5 SASI_Rn01_00054128 predicted 2576
6 SASI_Rn01_00054129 predicted 3046
7 SASI_Rn02_00264227 predicted 1972
8 SASI_Rn01_00054130 predicted 3101
9 SASI_Rn01_00054131 predicted 1727
10 SASI_Rn02_00264228 predicted 2363
11 SASI_Rn01_00054123 predicted 2821
12 SASI_Rn01_00054124 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170778 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343630 predicted 531
2 SASI_Mm01_00034219 predicted 2615
3 SASI_Mm01_00034221 predicted 2878
4 SASI_Mm01_00034222 predicted 1193
5 SASI_Mm01_00034223 predicted 3146
6 SASI_Mm01_00034224 predicted 2814
7 SASI_Mm02_00343631 predicted 1441
8 SASI_Mm01_00034226 predicted 800
9 SASI_Mm01_00034227 predicted 837
10 SASI_Mm01_00034228 predicted 1584
11 SASI_Mm01_00034220 predicted 931
12 SASI_Mm01_00034225 predicted 1381
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000110
VALIDATED
DPYD MISSION shRNA Bacterial Glycerol Stock
dihydropyrimidine dehydrogenase
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000110.2-370s1c1
Sequence:CCGGGCTGTCCAACTAATCTTGATACTCGAGTATCAAGATTAGTTGGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000110.2-1951s1c1
Sequence:CCGGCGGCTGCATATTGGTGTCAAACTCGAGTTTGACACCAATATGCAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_000110.2-569s1c1
Sequence:CCGGGCAATTTGCTACTGAGGTATTCTCGAGAATACCTCAGTAGCAAATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_000110.2-809s1c1
Sequence:CCGGGCCGTATGATGTAGTGAATTTCTCGAGAAATTCACTACATCATACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_000110.2-3009s1c1
Sequence:CCGGGCTATACAGTTTGATCCAGAACTCGAGTTCTGGATCAAACTGTATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000110.3-544s21c1
Sequence:CCGGGTGTAGGTGGATGCAATTTATCTCGAGATAAATTGCATCCACCTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000110.3-2041s21c1
Sequence:CCGGACATTGTGATTGCTAGCATTACTCGAGTAATGCTAGCAATCACAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000110.3-1748s21c1
Sequence:CCGGGGCCGGATTGAAGTTTATAAACTCGAGTTTATAAACTTCAATCCGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000110.3-3392s21c1
Sequence:CCGGCATTCAATTAGTGGTCATAAACTCGAGTTTATGACCACTAATTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000110.3-1627s21c1
Sequence:CCGGAGCAAGCTTCTTGGTACATTCCTCGAGGAATGTACCAAGAAGCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000110.3-570s21c1
Sequence:CCGGACTGAAGAGGGACCCATTAATCTCGAGATTAATGGGTCCCTCTTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000110.3-2962s21c1
Sequence:CCGGAGCAAGTTGTGGCTATGATTGCTCGAGCAATCATAGCCACAACTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000110
VALIDATED
DPYD MISSION shRNA shRNA Plasmid DNA
dihydropyrimidine dehydrogenase
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000110.2-370s1c1
Sequence:CCGGGCTGTCCAACTAATCTTGATACTCGAGTATCAAGATTAGTTGGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000110.2-1951s1c1
Sequence:CCGGCGGCTGCATATTGGTGTCAAACTCGAGTTTGACACCAATATGCAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_000110.2-569s1c1
Sequence:CCGGGCAATTTGCTACTGAGGTATTCTCGAGAATACCTCAGTAGCAAATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_000110.2-809s1c1
Sequence:CCGGGCCGTATGATGTAGTGAATTTCTCGAGAAATTCACTACATCATACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_000110.2-3009s1c1
Sequence:CCGGGCTATACAGTTTGATCCAGAACTCGAGTTCTGGATCAAACTGTATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000110.3-544s21c1
Sequence:CCGGGTGTAGGTGGATGCAATTTATCTCGAGATAAATTGCATCCACCTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000110.3-2041s21c1
Sequence:CCGGACATTGTGATTGCTAGCATTACTCGAGTAATGCTAGCAATCACAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000110.3-1748s21c1
Sequence:CCGGGGCCGGATTGAAGTTTATAAACTCGAGTTTATAAACTTCAATCCGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000110.3-3392s21c1
Sequence:CCGGCATTCAATTAGTGGTCATAAACTCGAGTTTATGACCACTAATTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000110.3-1627s21c1
Sequence:CCGGAGCAAGCTTCTTGGTACATTCCTCGAGGAATGTACCAAGAAGCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000110.3-570s21c1
Sequence:CCGGACTGAAGAGGGACCCATTAATCTCGAGATTAATGGGTCCCTCTTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000110.3-2962s21c1
Sequence:CCGGAGCAAGTTGTGGCTATGATTGCTCGAGCAATCATAGCCACAACTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000110
VALIDATED
DPYD MISSION shRNA Lentiviral Transduction Particles
dihydropyrimidine dehydrogenase
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000110.2-370s1c1
Sequence:CCGGGCTGTCCAACTAATCTTGATACTCGAGTATCAAGATTAGTTGGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000110.2-1951s1c1
Sequence:CCGGCGGCTGCATATTGGTGTCAAACTCGAGTTTGACACCAATATGCAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_000110.2-569s1c1
Sequence:CCGGGCAATTTGCTACTGAGGTATTCTCGAGAATACCTCAGTAGCAAATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_000110.2-809s1c1
Sequence:CCGGGCCGTATGATGTAGTGAATTTCTCGAGAAATTCACTACATCATACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_000110.2-3009s1c1
Sequence:CCGGGCTATACAGTTTGATCCAGAACTCGAGTTCTGGATCAAACTGTATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000110.3-544s21c1
Sequence:CCGGGTGTAGGTGGATGCAATTTATCTCGAGATAAATTGCATCCACCTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000110.3-2041s21c1
Sequence:CCGGACATTGTGATTGCTAGCATTACTCGAGTAATGCTAGCAATCACAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000110.3-1748s21c1
Sequence:CCGGGGCCGGATTGAAGTTTATAAACTCGAGTTTATAAACTTCAATCCGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000110.3-3392s21c1
Sequence:CCGGCATTCAATTAGTGGTCATAAACTCGAGTTTATGACCACTAATTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000110.3-1627s21c1
Sequence:CCGGAGCAAGCTTCTTGGTACATTCCTCGAGGAATGTACCAAGAAGCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000110.3-570s21c1
Sequence:CCGGACTGAAGAGGGACCCATTAATCTCGAGATTAATGGGTCCCTCTTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000110.3-2962s21c1
Sequence:CCGGAGCAAGTTGTGGCTATGATTGCTCGAGCAATCATAGCCACAACTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170778
DPYD MISSION shRNA Bacterial Glycerol Stock
dihydropyrimidine dehydrogenase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170778.1-2854s1c1
Sequence:CCGGCCTGCCATCAAGGATGTAATTCTCGAGAATTACATCCTTGATGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170778.1-2550s1c1
Sequence:CCGGCGCTATTCAGAATCAGGACTTCTCGAGAAGTCCTGATTCTGAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170778.1-1276s1c1
Sequence:CCGGCCACGGAAGGTTATAGTCAAACTCGAGTTTGACTATAACCTTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170778.1-192s1c1
Sequence:CCGGCGCAGCCAAGAAACTAGACAACTCGAGTTGTCTAGTTTCTTGGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170778.1-374s1c1
Sequence:CCGGCCACATCTCTTGACATTAAATCTCGAGATTTAATGTCAAGAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170778
DPYD MISSION shRNA shRNA Plasmid DNA
dihydropyrimidine dehydrogenase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170778.1-2854s1c1
Sequence:CCGGCCTGCCATCAAGGATGTAATTCTCGAGAATTACATCCTTGATGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170778.1-2550s1c1
Sequence:CCGGCGCTATTCAGAATCAGGACTTCTCGAGAAGTCCTGATTCTGAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170778.1-1276s1c1
Sequence:CCGGCCACGGAAGGTTATAGTCAAACTCGAGTTTGACTATAACCTTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170778.1-192s1c1
Sequence:CCGGCGCAGCCAAGAAACTAGACAACTCGAGTTGTCTAGTTTCTTGGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170778.1-374s1c1
Sequence:CCGGCCACATCTCTTGACATTAAATCTCGAGATTTAATGTCAAGAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170778
DPYD MISSION shRNA Lentiviral Transduction Particles
dihydropyrimidine dehydrogenase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170778.1-2854s1c1
Sequence:CCGGCCTGCCATCAAGGATGTAATTCTCGAGAATTACATCCTTGATGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170778.1-2550s1c1
Sequence:CCGGCGCTATTCAGAATCAGGACTTCTCGAGAAGTCCTGATTCTGAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170778.1-1276s1c1
Sequence:CCGGCCACGGAAGGTTATAGTCAAACTCGAGTTTGACTATAACCTTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170778.1-192s1c1
Sequence:CCGGCGCAGCCAAGAAACTAGACAACTCGAGTTGTCTAGTTTCTTGGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170778.1-374s1c1
Sequence:CCGGCCACATCTCTTGACATTAAATCTCGAGATTTAATGTCAAGAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks