EMAIL THIS PAGE TO A FRIEND

DPYS

dihydropyrimidinase

56 Gene Product Result for
Synonyms: DHP DHPase
UniProtKB ID: Q14117
Gene ID:
Human(1807) Summary: Dihydropyrimidinase catalyzes the conversion of 5,6-dihydrouracil to 3-ureidopropionate in pyrimidine metabolism. Dihydropyrimidinase is expressed at a high level in liver and kidney as a major 2.5-kb transcript and a minor 3.8-kb transcript. Defects in the DPYS gene are linked to dihydropyrimidinuria. [provided by RefSeq, Jul 2008]
Mouse(64705) dihydropyrimidinase
Rat(65135) dihydropyrimidinase
Zebrafish(100144569) dihydropyrimidinase
cow(509241) dihydropyrimidinase
domestic cat(101085020) dihydropyrimidinase
dog(475067) dihydropyrimidinase
chicken(420266) dihydropyrimidinase
naked mole-rat(101723598) dihydropyrimidinase
domestic guinea pig(100717795) dihydropyrimidinase
sheep(101102070) dihydropyrimidinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001385 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001385 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001385 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022722 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022722 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022722 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120251 MISSION® esiRNA esiRNA human DPYS (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001385 Rosetta Predictions human pricing
NM_031705 Rosetta Predictions rat pricing
NM_022722 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001385 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160878 predicted 927
2 SASI_Hs01_00160879 predicted 1330
3 SASI_Hs01_00160880 predicted 889
4 SASI_Hs02_00331747 predicted 1124
5 SASI_Hs01_00160881 predicted 731
6 SASI_Hs01_00160882 predicted 447
7 SASI_Hs02_00331748 predicted 1502
8 SASI_Hs01_00160885 predicted 1321
9 SASI_Hs01_00160886 predicted 1304
10 SASI_Hs01_00160887 predicted 1080
11 SASI_Hs01_00160883 predicted 1441
12 SASI_Hs01_00160884 predicted 852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031705 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265062 predicted 809
2 SASI_Rn01_00043674 predicted 1065
3 SASI_Rn01_00043676 predicted 487
4 SASI_Rn01_00043677 predicted 1466
5 SASI_Rn01_00043678 predicted 1292
6 SASI_Rn01_00043679 predicted 1341
7 SASI_Rn01_00043680 predicted 818
8 SASI_Rn01_00043681 predicted 1044
9 SASI_Rn02_00265063 predicted 580
10 SASI_Rn01_00043682 predicted 539
11 SASI_Rn01_00043675 predicted 1254
12 SASI_Rn01_00043683 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022722 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099495 predicted 1257
2 SASI_Mm01_00099496 predicted 601
3 SASI_Mm01_00099497 predicted 825
4 SASI_Mm01_00099498 predicted 480
5 SASI_Mm01_00099499 predicted 465
6 SASI_Mm01_00099500 predicted 1376
7 SASI_Mm01_00099501 predicted 1306
8 SASI_Mm01_00099502 predicted 830
9 SASI_Mm01_00099503 predicted 1510
10 SASI_Mm01_00099504 predicted 1707
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001385
DPYS MISSION shRNA Bacterial Glycerol Stock
dihydropyrimidinase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001385.2-1590s21c1
Sequence:CCGGTGTGGAGCGTGCACCCTATAACTCGAGTTATAGGGTGCACGCTCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001385.2-1188s21c1
Sequence:CCGGAGATCGGATGTCCGTAATATGCTCGAGCATATTACGGACATCCGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001385.2-1782s21c1
Sequence:CCGGTCAACTCCCTAGGATCCTTTACTCGAGTAAAGGATCCTAGGGAGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001385.1-411s1c1
Sequence:CCGGCACCACCATGATTATTGATTTCTCGAGAAATCAATAATCATGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001385.1-1444s1c1
Sequence:CCGGGTGACTATTTCAAGAGGCAAACTCGAGTTTGCCTCTTGAAATAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001385.1-603s1c1
Sequence:CCGGCAAGATGTTTATGGCCTATAACTCGAGTTATAGGCCATAAACATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001385.1-1076s1c1
Sequence:CCGGCTAATGATGATCTAACCACAACTCGAGTTGTGGTTAGATCATCATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001385.1-1251s1c1
Sequence:CCGGTGTGGCAGTTACCAGCACAAACTCGAGTTTGTGCTGGTAACTGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001385
DPYS MISSION shRNA shRNA Plasmid DNA
dihydropyrimidinase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001385.2-1590s21c1
Sequence:CCGGTGTGGAGCGTGCACCCTATAACTCGAGTTATAGGGTGCACGCTCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001385.2-1188s21c1
Sequence:CCGGAGATCGGATGTCCGTAATATGCTCGAGCATATTACGGACATCCGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001385.2-1782s21c1
Sequence:CCGGTCAACTCCCTAGGATCCTTTACTCGAGTAAAGGATCCTAGGGAGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001385.1-411s1c1
Sequence:CCGGCACCACCATGATTATTGATTTCTCGAGAAATCAATAATCATGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001385.1-1444s1c1
Sequence:CCGGGTGACTATTTCAAGAGGCAAACTCGAGTTTGCCTCTTGAAATAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001385.1-603s1c1
Sequence:CCGGCAAGATGTTTATGGCCTATAACTCGAGTTATAGGCCATAAACATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001385.1-1076s1c1
Sequence:CCGGCTAATGATGATCTAACCACAACTCGAGTTGTGGTTAGATCATCATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001385.1-1251s1c1
Sequence:CCGGTGTGGCAGTTACCAGCACAAACTCGAGTTTGTGCTGGTAACTGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001385
DPYS MISSION shRNA Lentiviral Transduction Particles
dihydropyrimidinase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001385.2-1590s21c1
Sequence:CCGGTGTGGAGCGTGCACCCTATAACTCGAGTTATAGGGTGCACGCTCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001385.2-1188s21c1
Sequence:CCGGAGATCGGATGTCCGTAATATGCTCGAGCATATTACGGACATCCGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001385.2-1782s21c1
Sequence:CCGGTCAACTCCCTAGGATCCTTTACTCGAGTAAAGGATCCTAGGGAGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001385.1-411s1c1
Sequence:CCGGCACCACCATGATTATTGATTTCTCGAGAAATCAATAATCATGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001385.1-1444s1c1
Sequence:CCGGGTGACTATTTCAAGAGGCAAACTCGAGTTTGCCTCTTGAAATAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001385.1-603s1c1
Sequence:CCGGCAAGATGTTTATGGCCTATAACTCGAGTTATAGGCCATAAACATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001385.1-1076s1c1
Sequence:CCGGCTAATGATGATCTAACCACAACTCGAGTTGTGGTTAGATCATCATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001385.1-1251s1c1
Sequence:CCGGTGTGGCAGTTACCAGCACAAACTCGAGTTTGTGCTGGTAACTGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022722
DPYS MISSION shRNA Bacterial Glycerol Stock
dihydropyrimidinase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022722.2-1014s1c1
Sequence:CCGGCGATCCTTTAACACCTGGCTTCTCGAGAAGCCAGGTGTTAAAGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022722.2-309s1c1
Sequence:CCGGGCACATGCAATTCCCGTTCATCTCGAGATGAACGGGAATTGCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022722.2-1511s1c1
Sequence:CCGGCCGAATACATTTACAAACGAACTCGAGTTCGTTTGTAAATGTATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022722.2-819s1c1
Sequence:CCGGCGCTGTGAACTGCCCTTTATACTCGAGTATAAAGGGCAGTTCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022722.2-681s1c1
Sequence:CCGGCGCCGAGAATGGAGATTTGATCTCGAGATCAAATCTCCATTCTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022722
DPYS MISSION shRNA shRNA Plasmid DNA
dihydropyrimidinase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022722.2-1014s1c1
Sequence:CCGGCGATCCTTTAACACCTGGCTTCTCGAGAAGCCAGGTGTTAAAGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022722.2-309s1c1
Sequence:CCGGGCACATGCAATTCCCGTTCATCTCGAGATGAACGGGAATTGCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022722.2-1511s1c1
Sequence:CCGGCCGAATACATTTACAAACGAACTCGAGTTCGTTTGTAAATGTATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022722.2-819s1c1
Sequence:CCGGCGCTGTGAACTGCCCTTTATACTCGAGTATAAAGGGCAGTTCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022722.2-681s1c1
Sequence:CCGGCGCCGAGAATGGAGATTTGATCTCGAGATCAAATCTCCATTCTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022722
DPYS MISSION shRNA Lentiviral Transduction Particles
dihydropyrimidinase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022722.2-1014s1c1
Sequence:CCGGCGATCCTTTAACACCTGGCTTCTCGAGAAGCCAGGTGTTAAAGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022722.2-309s1c1
Sequence:CCGGGCACATGCAATTCCCGTTCATCTCGAGATGAACGGGAATTGCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022722.2-1511s1c1
Sequence:CCGGCCGAATACATTTACAAACGAACTCGAGTTCGTTTGTAAATGTATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022722.2-819s1c1
Sequence:CCGGCGCTGTGAACTGCCCTTTATACTCGAGTATAAAGGGCAGTTCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022722.2-681s1c1
Sequence:CCGGCGCCGAGAATGGAGATTTGATCTCGAGATCAAATCTCCATTCTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks