EMAIL THIS PAGE TO A FRIEND

DPYSL2

dihydropyrimidinase-like 2

180 Gene Product Result for
Synonyms: CRMP-2 CRMP2 DHPRP2 DRP-2 DRP2 N2A3 ULIP-2 ULIP2
UniProtKB ID: Q16555, A8K5H2, B4DR31, D3DSS7, O00424
Gene ID:
Human(1808) Summary: This gene encodes a member of the collapsin response mediator protein family. Collapsin response mediator proteins form homo- and hetero-tetramers and facilitate neuron guidance, growth and polarity. The encoded protein promotes microtubule assembly and is required for Sema3A-mediated growth cone collapse, and also plays a role in synaptic signaling through interactions with calcium channels. This gene has been implicated in multiple neurological disorders, and hyperphosphorylation of the encoded protein may play a key role in the development of Alzheimer's disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
Mouse(12934) dihydropyrimidinase-like 2
Rat(25416) dihydropyrimidinase-like 2
sheep(101108984) dihydropyrimidinase-like 2
Domestic Rabbit(100351135) dihydropyrimidinase-like 2
domestic guinea pig(100734407) dihydropyrimidinase-like 2
naked mole-rat(101710925) dihydropyrimidinase-like 2
chicken(395155) dihydropyrimidinase-like 2
dog(486107) dihydropyrimidinase-like 2
cow(533746) dihydropyrimidinase-like 2
domestic cat(554340) dihydropyrimidinase-like 2
Gene Class: Amidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500669 Anti-CRMP-2, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
C2993 Anti-CRMP2 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution rat, mouse, human
western blot pricing
HPA002381 Anti-DPYSL2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2100624 Anti-DPYSL2 antibody produced in rabbit affinity isolated antibody zebrafish, canine, rat, rabbit, bovine, horse, guinea pig, human, mouse
western blot pricing
SAB4500668 Anti-DRP-2, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4301398 Anti-phospho-CRMP-2 (pSer522) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4504698 Anti-phospho-CRMP-2 (pThr509) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4301353 Anti-phospho-CRMP-2 (pThr509) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4504303 Anti-phospho-DRP-2 (pThr514) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4301551 Anti-phospho-DRP-2 (pThr514) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
SAB1402756 Monoclonal Anti-DPYSL2, (C-terminal) antibody produced in mouse clone 1F11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1305496 MONOCLONAL ANTI-DRP-2 antibody produced in mouse clone 33CT11.40.3, crude ascites, buffered aqueous solution human, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001386 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001386 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001386 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009955 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009955 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009955 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001386 Rosetta Predictions human pricing
NM_001105717 Rosetta Predictions rat pricing
NM_009955 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001386 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201107 predicted 561
2 SASI_Hs01_00201108 predicted 881
3 SASI_Hs01_00201109 predicted 1615
4 SASI_Hs01_00201110 predicted 759
5 SASI_Hs01_00201111 predicted 778
6 SASI_Hs01_00201112 predicted 1613
7 SASI_Hs01_00201113 predicted 1390
8 SASI_Hs01_00201114 predicted 1161
9 SASI_Hs01_00201115 predicted 1349
10 SASI_Hs01_00201116 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105717 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211836 predicted 1075
2 SASI_Rn02_00211837 predicted 1161
3 SASI_Rn02_00211838 predicted 1438
4 SASI_Rn02_00211839 predicted 1398
5 SASI_Rn02_00211840 predicted 1712
6 SASI_Rn02_00211841 predicted 579
7 SASI_Rn02_00211842 predicted 1026
8 SASI_Rn02_00211843 predicted 1649
9 SASI_Rn02_00211844 predicted 783
10 SASI_Rn02_00211845 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009955 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157057 predicted 1446
2 SASI_Mm01_00157058 predicted 1575
3 SASI_Mm02_00317517 predicted 528
4 SASI_Mm01_00157059 predicted 399
5 SASI_Mm01_00157060 predicted 792
6 SASI_Mm01_00157061 predicted 574
7 SASI_Mm01_00157064 predicted 1652
8 SASI_Mm01_00157065 predicted 622
9 SASI_Mm01_00157066 predicted 582
10 SASI_Mm02_00317518 predicted 1043
11 SASI_Mm01_00157062 predicted 832
12 SASI_Mm01_00157063 predicted 975
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001386
VALIDATED
DPYSL2 MISSION shRNA Bacterial Glycerol Stock
dihydropyrimidinase-like 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001386.3-1904s1c1
Sequence:CCGGGCTCAGATTGATGACAACATTCTCGAGAATGTTGTCATCAATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001386.3-1264s1c1
Sequence:CCGGCAGTGCCCATTGCACGTTTAACTCGAGTTAAACGTGCAATGGGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001386.3-799s1c1
Sequence:CCGGGCTAACGGATTGCCAGATTTACTCGAGTAAATCTGGCAATCCGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001386.3-371s1c1
Sequence:CCGGGCAGACATATACATGGAAGATCTCGAGATCTTCCATGTATATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001386.3-827s1c1
Sequence:CCGGCTGAGTGTGATCCGGGATATTCTCGAGAATATCCCGGATCACACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001386.4-903s21c1
Sequence:CCGGCTGAGTGTGATCCGGGATATTCTCGAGAATATCCCGGATCACACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001386.4-875s21c1
Sequence:CCGGGCTAACGGATTGCCAGATTTACTCGAGTAAATCTGGCAATCCGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303301    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001386.4-2170s21c1
Sequence:CCGGTTAAGAGCCTGTGATAGTTACCTCGAGGTAACTATCACAGGCTCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001386.4-1514s21c1
Sequence:CCGGAGCCAAAGTCTTCAACCTTTACTCGAGTAAAGGTTGAAGACTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001386.4-1084s21c1
Sequence:CCGGAGACCAACTGCCCGCTGTATACTCGAGTATACAGCGGGCAGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001386
VALIDATED
DPYSL2 MISSION shRNA shRNA Plasmid DNA
dihydropyrimidinase-like 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001386.3-1904s1c1
Sequence:CCGGGCTCAGATTGATGACAACATTCTCGAGAATGTTGTCATCAATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001386.3-1264s1c1
Sequence:CCGGCAGTGCCCATTGCACGTTTAACTCGAGTTAAACGTGCAATGGGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001386.3-799s1c1
Sequence:CCGGGCTAACGGATTGCCAGATTTACTCGAGTAAATCTGGCAATCCGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001386.3-371s1c1
Sequence:CCGGGCAGACATATACATGGAAGATCTCGAGATCTTCCATGTATATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001386.3-827s1c1
Sequence:CCGGCTGAGTGTGATCCGGGATATTCTCGAGAATATCCCGGATCACACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001386.4-903s21c1
Sequence:CCGGCTGAGTGTGATCCGGGATATTCTCGAGAATATCCCGGATCACACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001386.4-875s21c1
Sequence:CCGGGCTAACGGATTGCCAGATTTACTCGAGTAAATCTGGCAATCCGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303301    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001386.4-2170s21c1
Sequence:CCGGTTAAGAGCCTGTGATAGTTACCTCGAGGTAACTATCACAGGCTCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001386.4-1514s21c1
Sequence:CCGGAGCCAAAGTCTTCAACCTTTACTCGAGTAAAGGTTGAAGACTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001386.4-1084s21c1
Sequence:CCGGAGACCAACTGCCCGCTGTATACTCGAGTATACAGCGGGCAGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001386
VALIDATED
DPYSL2 MISSION shRNA Lentiviral Transduction Particles
dihydropyrimidinase-like 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001386.3-1904s1c1
Sequence:CCGGGCTCAGATTGATGACAACATTCTCGAGAATGTTGTCATCAATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001386.3-1264s1c1
Sequence:CCGGCAGTGCCCATTGCACGTTTAACTCGAGTTAAACGTGCAATGGGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001386.3-799s1c1
Sequence:CCGGGCTAACGGATTGCCAGATTTACTCGAGTAAATCTGGCAATCCGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001386.3-371s1c1
Sequence:CCGGGCAGACATATACATGGAAGATCTCGAGATCTTCCATGTATATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001386.3-827s1c1
Sequence:CCGGCTGAGTGTGATCCGGGATATTCTCGAGAATATCCCGGATCACACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001386.4-903s21c1
Sequence:CCGGCTGAGTGTGATCCGGGATATTCTCGAGAATATCCCGGATCACACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001386.4-875s21c1
Sequence:CCGGGCTAACGGATTGCCAGATTTACTCGAGTAAATCTGGCAATCCGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303301    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001386.4-2170s21c1
Sequence:CCGGTTAAGAGCCTGTGATAGTTACCTCGAGGTAACTATCACAGGCTCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001386.4-1514s21c1
Sequence:CCGGAGCCAAAGTCTTCAACCTTTACTCGAGTAAAGGTTGAAGACTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001386.4-1084s21c1
Sequence:CCGGAGACCAACTGCCCGCTGTATACTCGAGTATACAGCGGGCAGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009955
VALIDATED
DPYSL2 MISSION shRNA Bacterial Glycerol Stock
dihydropyrimidinase-like 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032639    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009955.2-3877s1c1
Sequence:CCGGCCCTGTTTATTTGTTTGGATTCTCGAGAATCCAAACAAATAAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009955.2-315s1c1
Sequence:CCGGCCAGTCCTTCTATGCAGACATCTCGAGATGTCTGCATAGAAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009955.2-1861s1c1
Sequence:CCGGGCTCAGATTGACGACAACATTCTCGAGAATGTTGTCGTCAATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009955.2-1393s1c1
Sequence:CCGGGCAGCCAAAGTCTTCAACCTTCTCGAGAAGGTTGAAGACTTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009955.2-723s1c1
Sequence:CCGGCCTCGTGTACATGGCTTTCAACTCGAGTTGAAAGCCATGTACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009955.3-939s21c1
Sequence:CCGGTGAACCGGTCCATCACTATTGCTCGAGCAATAGTGATGGACCGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009955.3-724s21c1
Sequence:CCGGCCTCGTGTACATGGCTTTCAACTCGAGTTGAAAGCCATGTACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009955.3-316s21c1
Sequence:CCGGCCAGTCCTTCTATGCAGACATCTCGAGATGTCTGCATAGAAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305056    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009955.3-2422s21c1
Sequence:CCGGTGAAAGCCTGATTCAATATTACTCGAGTAATATTGAATCAGGCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009955.3-1862s21c1
Sequence:CCGGGCTCAGATTGACGACAACATTCTCGAGAATGTTGTCGTCAATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009955
VALIDATED
DPYSL2 MISSION shRNA shRNA Plasmid DNA
dihydropyrimidinase-like 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032639    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009955.2-3877s1c1
Sequence:CCGGCCCTGTTTATTTGTTTGGATTCTCGAGAATCCAAACAAATAAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009955.2-315s1c1
Sequence:CCGGCCAGTCCTTCTATGCAGACATCTCGAGATGTCTGCATAGAAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009955.2-1861s1c1
Sequence:CCGGGCTCAGATTGACGACAACATTCTCGAGAATGTTGTCGTCAATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009955.2-1393s1c1
Sequence:CCGGGCAGCCAAAGTCTTCAACCTTCTCGAGAAGGTTGAAGACTTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009955.2-723s1c1
Sequence:CCGGCCTCGTGTACATGGCTTTCAACTCGAGTTGAAAGCCATGTACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009955.3-939s21c1
Sequence:CCGGTGAACCGGTCCATCACTATTGCTCGAGCAATAGTGATGGACCGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009955.3-724s21c1
Sequence:CCGGCCTCGTGTACATGGCTTTCAACTCGAGTTGAAAGCCATGTACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009955.3-316s21c1
Sequence:CCGGCCAGTCCTTCTATGCAGACATCTCGAGATGTCTGCATAGAAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305056    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009955.3-2422s21c1
Sequence:CCGGTGAAAGCCTGATTCAATATTACTCGAGTAATATTGAATCAGGCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009955.3-1862s21c1
Sequence:CCGGGCTCAGATTGACGACAACATTCTCGAGAATGTTGTCGTCAATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009955
VALIDATED
DPYSL2 MISSION shRNA Lentiviral Transduction Particles
dihydropyrimidinase-like 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032639    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009955.2-3877s1c1
Sequence:CCGGCCCTGTTTATTTGTTTGGATTCTCGAGAATCCAAACAAATAAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009955.2-315s1c1
Sequence:CCGGCCAGTCCTTCTATGCAGACATCTCGAGATGTCTGCATAGAAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009955.2-1861s1c1
Sequence:CCGGGCTCAGATTGACGACAACATTCTCGAGAATGTTGTCGTCAATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009955.2-1393s1c1
Sequence:CCGGGCAGCCAAAGTCTTCAACCTTCTCGAGAAGGTTGAAGACTTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009955.2-723s1c1
Sequence:CCGGCCTCGTGTACATGGCTTTCAACTCGAGTTGAAAGCCATGTACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009955.3-939s21c1
Sequence:CCGGTGAACCGGTCCATCACTATTGCTCGAGCAATAGTGATGGACCGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009955.3-724s21c1
Sequence:CCGGCCTCGTGTACATGGCTTTCAACTCGAGTTGAAAGCCATGTACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009955.3-316s21c1
Sequence:CCGGCCAGTCCTTCTATGCAGACATCTCGAGATGTCTGCATAGAAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305056    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009955.3-2422s21c1
Sequence:CCGGTGAAAGCCTGATTCAATATTACTCGAGTAATATTGAATCAGGCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009955.3-1862s21c1
Sequence:CCGGGCTCAGATTGACGACAACATTCTCGAGAATGTTGTCGTCAATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks