EMAIL THIS PAGE TO A FRIEND

DPYSL3

dihydropyrimidinase-like 3

123 Gene Product Result for
Synonyms: CRMP-4 CRMP4 DRP-3 DRP3 LCRMP ULIP ULIP-1
UniProtKB ID: Q14195, B3SXQ8, Q93012
Gene ID:
Mouse(22240) dihydropyrimidinase-like 3
Rat(25418) dihydropyrimidinase-like 3
Zebrafish(553166) dihydropyrimidinase-like 3
cow(509796) dihydropyrimidinase-like 3
Horse(100071913) dihydropyrimidinase-like 3
domestic cat(554341) dihydropyrimidinase-like 3
dog(487204) dihydropyrimidinase-like 3
chicken(395154) dihydropyrimidinase-like 3
naked mole-rat(101702923) dihydropyrimidinase-like 3
domestic guinea pig(100717407) dihydropyrimidinase-like 3
sheep(101114775) dihydropyrimidinase-like 3
Domestic Rabbit(100339217) dihydropyrimidinase-like 3
Gene Class: Amidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001387 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001387 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001387 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009468 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009468 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009468 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001387 Rosetta Predictions human pricing
NM_012934 Rosetta Predictions rat pricing
NM_009468 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001387 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065695 predicted 1296
2 SASI_Hs02_00331749 predicted 1437
3 SASI_Hs01_00065696 predicted 1594
4 SASI_Hs01_00065697 predicted 1533
5 SASI_Hs01_00065698 predicted 506
6 SASI_Hs01_00065699 predicted 604
7 SASI_Hs01_00065701 predicted 1698
8 SASI_Hs02_00331750 predicted 246
9 SASI_Hs01_00065702 predicted 1547
10 SASI_Hs01_00065703 predicted 1035
11 SASI_Hs01_00065700 predicted 625
12 SASI_Hs01_00065704 predicted 638
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012934 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093263 predicted 1512
2 SASI_Rn01_00093264 predicted 245
3 SASI_Rn01_00093265 predicted 924
4 SASI_Rn01_00093266 predicted 390
5 SASI_Rn01_00093267 predicted 862
6 SASI_Rn01_00093268 predicted 1506
7 SASI_Rn01_00093269 predicted 557
8 SASI_Rn02_00260492 predicted 821
9 SASI_Rn01_00093270 predicted 467
10 SASI_Rn01_00093272 predicted 1486
11 SASI_Rn01_00093271 predicted 1423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009468 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316190 predicted 1738
2 SASI_Mm01_00185494 predicted 1143
3 SASI_Mm01_00185495 predicted 1042
4 SASI_Mm01_00185496 predicted 779
5 SASI_Mm01_00185498 predicted 1084
6 SASI_Mm01_00185501 predicted 808
7 SASI_Mm01_00185502 predicted 697
8 SASI_Mm01_00185503 predicted 1494
9 SASI_Mm02_00316191 predicted 363
10 SASI_Mm02_00316192 predicted 1109
11 SASI_Mm01_00185497 predicted 625
12 SASI_Mm01_00185499 predicted 1814
13 SASI_Mm01_00185500 predicted 1733
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001387
DPYSL3 MISSION shRNA Bacterial Glycerol Stock
dihydropyrimidinase-like 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434998    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001387.2-1913s21c1
Sequence:CCGGCCAAACGGTTGTGATCTAAAGCTCGAGCTTTAGATCACAACCGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001387.2-593s21c1
Sequence:CCGATAACTCCTTCATGGTTTATATCTCGAGATATAAACCATGAAGGAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001387.2-959s1c1
Sequence:CCGGCGGCATAGATGGAACCCATTACTCGAGTAATGGGTTCCATCTATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001387.2-1535s1c1
Sequence:CCGGCGACTATGTCTACAAGCGCATCTCGAGATGCGCTTGTAGACATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001387.2-693s1c1
Sequence:CCGGGCTCAAGTTCATGCTGAGAATCTCGAGATTCTCAGCATGAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001387.2-1392s1c1
Sequence:CCGGGCGGCAGAGTACAACATCTTTCTCGAGAAAGATGTTGTACTCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001387.2-207s1c1
Sequence:CCGGGCTGATATTTACATGGAAGATCTCGAGATCTTCCATGTAAATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001387
DPYSL3 MISSION shRNA shRNA Plasmid DNA
dihydropyrimidinase-like 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434998    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001387.2-1913s21c1
Sequence:CCGGCCAAACGGTTGTGATCTAAAGCTCGAGCTTTAGATCACAACCGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001387.2-593s21c1
Sequence:CCGATAACTCCTTCATGGTTTATATCTCGAGATATAAACCATGAAGGAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001387.2-959s1c1
Sequence:CCGGCGGCATAGATGGAACCCATTACTCGAGTAATGGGTTCCATCTATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001387.2-1535s1c1
Sequence:CCGGCGACTATGTCTACAAGCGCATCTCGAGATGCGCTTGTAGACATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001387.2-693s1c1
Sequence:CCGGGCTCAAGTTCATGCTGAGAATCTCGAGATTCTCAGCATGAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001387.2-1392s1c1
Sequence:CCGGGCGGCAGAGTACAACATCTTTCTCGAGAAAGATGTTGTACTCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001387.2-207s1c1
Sequence:CCGGGCTGATATTTACATGGAAGATCTCGAGATCTTCCATGTAAATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001387
DPYSL3 MISSION shRNA Lentiviral Transduction Particles
dihydropyrimidinase-like 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434998    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001387.2-1913s21c1
Sequence:CCGGCCAAACGGTTGTGATCTAAAGCTCGAGCTTTAGATCACAACCGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001387.2-593s21c1
Sequence:CCGATAACTCCTTCATGGTTTATATCTCGAGATATAAACCATGAAGGAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001387.2-959s1c1
Sequence:CCGGCGGCATAGATGGAACCCATTACTCGAGTAATGGGTTCCATCTATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001387.2-1535s1c1
Sequence:CCGGCGACTATGTCTACAAGCGCATCTCGAGATGCGCTTGTAGACATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001387.2-693s1c1
Sequence:CCGGGCTCAAGTTCATGCTGAGAATCTCGAGATTCTCAGCATGAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001387.2-1392s1c1
Sequence:CCGGGCGGCAGAGTACAACATCTTTCTCGAGAAAGATGTTGTACTCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001387.2-207s1c1
Sequence:CCGGGCTGATATTTACATGGAAGATCTCGAGATCTTCCATGTAAATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009468
VALIDATED
DPYSL3 MISSION shRNA Bacterial Glycerol Stock
dihydropyrimidinase-like 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009468.4-1588s21c1
Sequence:CCGGGCCGAATACAACATCTTTGAACTCGAGTTCAAAGATGTTGTATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009468.4-1720s21c1
Sequence:CCGGCCATTCTCTGACTATGTCTATCTCGAGATAGACATAGTCAGAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009468.4-886s21c1
Sequence:CCGGGCTCAAGTTCATGCCGAGAATCTCGAGATTCTCGGCATGAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009468.4-1743s21c1
Sequence:CCGGGCGCATTAAAGCAAGGAGGAACTCGAGTTCCTCCTTGCTTTAATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009468.4-808s21c1
Sequence:CCGGGCCTACAAGGATTTATATCAACTCGAGTTGATATAAATCCTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009468.1-814s1c1
Sequence:CCGGGCCTACAAGGATTTATATCAACTCGAGTTGATATAAATCCTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009468.1-1726s1c1
Sequence:CCGGCCATTCTCTGACTATGTCTATCTCGAGATAGACATAGTCAGAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009468.1-1749s1c1
Sequence:CCGGGCGCATTAAAGCAAGGAGGAACTCGAGTTCCTCCTTGCTTTAATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009468.1-892s1c1
Sequence:CCGGGCTCAAGTTCATGCCGAGAATCTCGAGATTCTCGGCATGAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009468.1-1594s1c1
Sequence:CCGGGCCGAATACAACATCTTTGAACTCGAGTTCAAAGATGTTGTATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009468
VALIDATED
DPYSL3 MISSION shRNA shRNA Plasmid DNA
dihydropyrimidinase-like 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009468.4-1588s21c1
Sequence:CCGGGCCGAATACAACATCTTTGAACTCGAGTTCAAAGATGTTGTATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009468.4-1720s21c1
Sequence:CCGGCCATTCTCTGACTATGTCTATCTCGAGATAGACATAGTCAGAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009468.4-886s21c1
Sequence:CCGGGCTCAAGTTCATGCCGAGAATCTCGAGATTCTCGGCATGAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009468.4-1743s21c1
Sequence:CCGGGCGCATTAAAGCAAGGAGGAACTCGAGTTCCTCCTTGCTTTAATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009468.4-808s21c1
Sequence:CCGGGCCTACAAGGATTTATATCAACTCGAGTTGATATAAATCCTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009468.1-814s1c1
Sequence:CCGGGCCTACAAGGATTTATATCAACTCGAGTTGATATAAATCCTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009468.1-1726s1c1
Sequence:CCGGCCATTCTCTGACTATGTCTATCTCGAGATAGACATAGTCAGAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009468.1-1749s1c1
Sequence:CCGGGCGCATTAAAGCAAGGAGGAACTCGAGTTCCTCCTTGCTTTAATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009468.1-892s1c1
Sequence:CCGGGCTCAAGTTCATGCCGAGAATCTCGAGATTCTCGGCATGAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009468.1-1594s1c1
Sequence:CCGGGCCGAATACAACATCTTTGAACTCGAGTTCAAAGATGTTGTATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009468
VALIDATED
DPYSL3 MISSION shRNA Lentiviral Transduction Particles
dihydropyrimidinase-like 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009468.4-1588s21c1
Sequence:CCGGGCCGAATACAACATCTTTGAACTCGAGTTCAAAGATGTTGTATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009468.4-1720s21c1
Sequence:CCGGCCATTCTCTGACTATGTCTATCTCGAGATAGACATAGTCAGAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009468.4-886s21c1
Sequence:CCGGGCTCAAGTTCATGCCGAGAATCTCGAGATTCTCGGCATGAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009468.4-1743s21c1
Sequence:CCGGGCGCATTAAAGCAAGGAGGAACTCGAGTTCCTCCTTGCTTTAATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009468.4-808s21c1
Sequence:CCGGGCCTACAAGGATTTATATCAACTCGAGTTGATATAAATCCTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009468.1-814s1c1
Sequence:CCGGGCCTACAAGGATTTATATCAACTCGAGTTGATATAAATCCTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009468.1-1726s1c1
Sequence:CCGGCCATTCTCTGACTATGTCTATCTCGAGATAGACATAGTCAGAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009468.1-1749s1c1
Sequence:CCGGGCGCATTAAAGCAAGGAGGAACTCGAGTTCCTCCTTGCTTTAATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009468.1-892s1c1
Sequence:CCGGGCTCAAGTTCATGCCGAGAATCTCGAGATTCTCGGCATGAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009468.1-1594s1c1
Sequence:CCGGGCCGAATACAACATCTTTGAACTCGAGTTCAAAGATGTTGTATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks