EMAIL THIS PAGE TO A FRIEND

DPYSL4

dihydropyrimidinase-like 4

Synonyms: CRMP3 DRP-4 ULIP4
UniProtKB ID: O14531, B2RMQ1, D3DRG5, O00240, Q5T0Q7
Gene ID:
Mouse(26757) dihydropyrimidinase-like 4
Rat(25417) dihydropyrimidinase-like 4
sheep(101108975) dihydropyrimidinase-like 4
domestic guinea pig(100730694) dihydropyrimidinase-like 4
naked mole-rat(101708483) dihydropyrimidinase-like 4
Zebrafish(553411) dihydropyrimidinase-like 4
dog(491588) dihydropyrimidinase-like 4
domestic cat(101086601) dihydropyrimidinase-like 4
cow(511863) dihydropyrimidinase-like 4
chicken(374022) dihydropyrimidinase-like 4
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006426 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006426 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006426 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011993 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011993 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011993 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006426 Rosetta Predictions human pricing
NM_012933 Rosetta Predictions rat pricing
NM_011993 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152190 predicted 1224
2 SASI_Hs01_00152191 predicted 446
3 SASI_Hs01_00152192 predicted 1589
4 SASI_Hs01_00152193 predicted 854
5 SASI_Hs02_00341547 predicted 1004
6 SASI_Hs01_00152194 predicted 334
7 SASI_Hs01_00152195 predicted 449
8 SASI_Hs01_00152196 predicted 1563
9 SASI_Hs01_00152198 predicted 1726
10 SASI_Hs02_00341548 predicted 618
11 SASI_Hs01_00152189 predicted 1403
12 SASI_Hs01_00152197 predicted 679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012933 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260482 predicted 1530
2 SASI_Rn02_00260483 predicted 1384
3 SASI_Rn02_00260484 predicted 628
4 SASI_Rn02_00260485 predicted 1170
5 SASI_Rn02_00260486 predicted 421
6 SASI_Rn02_00260487 predicted 1899
7 SASI_Rn02_00260488 predicted 502
8 SASI_Rn02_00260489 predicted 1889
9 SASI_Rn02_00260490 predicted 1559
10 SASI_Rn02_00260491 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011993 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106572 predicted 1392
2 SASI_Mm02_00321919 predicted 203
3 SASI_Mm01_00106573 predicted 640
4 SASI_Mm02_00321920 predicted 205
5 SASI_Mm01_00106574 predicted 519
6 SASI_Mm01_00106575 predicted 428
7 SASI_Mm01_00106576 predicted 1901
8 SASI_Mm01_00106577 predicted 867
9 SASI_Mm01_00106578 predicted 642
10 SASI_Mm01_00106579 predicted 862
11 SASI_Mm01_00106580 predicted 358
12 SASI_Mm01_00106581 predicted 1833
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006426
VALIDATED
DPYSL4 MISSION shRNA Bacterial Glycerol Stock
dihydropyrimidinase-like 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006426.1-1420s1c1
Sequence:CCGGCCACAATCTGAACGTGGAGTACTCGAGTACTCCACGTTCAGATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006426.1-1576s1c1
Sequence:CCGGCTTTGTCTACAAGAGGATCAACTCGAGTTGATCCTCTTGTAGACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006426.1-254s1c1
Sequence:CCGGCACGTGGAAGATGGCTTGATACTCGAGTATCAAGCCATCTTCCACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006426.1-880s1c1
Sequence:CCGGGCAGGCAAACTGCCCGCTGTACTCGAGTACAGCGGGCAGTTTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006426.1-1006s1c1
Sequence:CCGGCGGTTCACACTACTGGAGCAACTCGAGTTGCTCCAGTAGTGTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006426.2-260s21c1
Sequence:CCGGCACGTGGAAGATGGCTTGATACTCGAGTATCAAGCCATCTTCCACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006426.2-1012s21c1
Sequence:CCGGCGGTTCACACTACTGGAGCAACTCGAGTTGCTCCAGTAGTGTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006426.2-1426s21c1
Sequence:CCGGCCACAATCTGAACGTGGAGTACTCGAGTACTCCACGTTCAGATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006426.2-1968s21c1
Sequence:CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006426.2-1295s21c1
Sequence:CCGGGTCGCGGTGACCAGTACAAATCTCGAGATTTGTACTGGTCACCGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006426
VALIDATED
DPYSL4 MISSION shRNA shRNA Plasmid DNA
dihydropyrimidinase-like 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006426.1-1420s1c1
Sequence:CCGGCCACAATCTGAACGTGGAGTACTCGAGTACTCCACGTTCAGATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006426.1-1576s1c1
Sequence:CCGGCTTTGTCTACAAGAGGATCAACTCGAGTTGATCCTCTTGTAGACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006426.1-254s1c1
Sequence:CCGGCACGTGGAAGATGGCTTGATACTCGAGTATCAAGCCATCTTCCACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006426.1-880s1c1
Sequence:CCGGGCAGGCAAACTGCCCGCTGTACTCGAGTACAGCGGGCAGTTTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006426.1-1006s1c1
Sequence:CCGGCGGTTCACACTACTGGAGCAACTCGAGTTGCTCCAGTAGTGTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006426.2-260s21c1
Sequence:CCGGCACGTGGAAGATGGCTTGATACTCGAGTATCAAGCCATCTTCCACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006426.2-1012s21c1
Sequence:CCGGCGGTTCACACTACTGGAGCAACTCGAGTTGCTCCAGTAGTGTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006426.2-1426s21c1
Sequence:CCGGCCACAATCTGAACGTGGAGTACTCGAGTACTCCACGTTCAGATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006426.2-1968s21c1
Sequence:CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006426.2-1295s21c1
Sequence:CCGGGTCGCGGTGACCAGTACAAATCTCGAGATTTGTACTGGTCACCGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006426
VALIDATED
DPYSL4 MISSION shRNA Lentiviral Transduction Particles
dihydropyrimidinase-like 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006426.1-1420s1c1
Sequence:CCGGCCACAATCTGAACGTGGAGTACTCGAGTACTCCACGTTCAGATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006426.1-1576s1c1
Sequence:CCGGCTTTGTCTACAAGAGGATCAACTCGAGTTGATCCTCTTGTAGACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006426.1-254s1c1
Sequence:CCGGCACGTGGAAGATGGCTTGATACTCGAGTATCAAGCCATCTTCCACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006426.1-880s1c1
Sequence:CCGGGCAGGCAAACTGCCCGCTGTACTCGAGTACAGCGGGCAGTTTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006426.1-1006s1c1
Sequence:CCGGCGGTTCACACTACTGGAGCAACTCGAGTTGCTCCAGTAGTGTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006426.2-260s21c1
Sequence:CCGGCACGTGGAAGATGGCTTGATACTCGAGTATCAAGCCATCTTCCACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006426.2-1012s21c1
Sequence:CCGGCGGTTCACACTACTGGAGCAACTCGAGTTGCTCCAGTAGTGTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006426.2-1426s21c1
Sequence:CCGGCCACAATCTGAACGTGGAGTACTCGAGTACTCCACGTTCAGATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006426.2-1968s21c1
Sequence:CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006426.2-1295s21c1
Sequence:CCGGGTCGCGGTGACCAGTACAAATCTCGAGATTTGTACTGGTCACCGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011993
DPYSL4 MISSION shRNA Bacterial Glycerol Stock
dihydropyrimidinase-like 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011993.2-1840s1c1
Sequence:CCGGCCTTCCTTTGTAGATTGTTATCTCGAGATAACAATCTACAAAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011993.2-166s1c1
Sequence:CCGGGACGGTCTGATTAAACAAATTCTCGAGAATTTGTTTAATCAGACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011993.2-1555s1c1
Sequence:CCGGCCTGTGCATGAAGTGATGTTACTCGAGTAACATCACTTCATGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011993.2-585s1c1
Sequence:CCGGCGGTCAGATATATGAAATCTTCTCGAGAAGATTTCATATATCTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011993.2-1323s1c1
Sequence:CCGGCCATAACCTGAATGTAGAGTACTCGAGTACTCTACATTCAGGTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011993.4-1817s21c1
Sequence:CCGGCTCCAACATCACGTCTCTTTCCTCGAGGAAAGAGACGTGATGTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011993.4-1444s21c1
Sequence:CCGGGAGTGCCCACGGTGGTCATAACTCGAGTTATGACCACCGTGGGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011993.4-1039s21c1
Sequence:CCGGCTATCAACCCGGACCCTACTACTCGAGTAGTAGGGTCCGGGTTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011993.4-526s21c1
Sequence:CCGGACTCCTTACATGTGGACATTCCTCGAGGAATGTCCACATGTAAGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011993
DPYSL4 MISSION shRNA shRNA Plasmid DNA
dihydropyrimidinase-like 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011993.2-1840s1c1
Sequence:CCGGCCTTCCTTTGTAGATTGTTATCTCGAGATAACAATCTACAAAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011993.2-166s1c1
Sequence:CCGGGACGGTCTGATTAAACAAATTCTCGAGAATTTGTTTAATCAGACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011993.2-1555s1c1
Sequence:CCGGCCTGTGCATGAAGTGATGTTACTCGAGTAACATCACTTCATGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011993.2-585s1c1
Sequence:CCGGCGGTCAGATATATGAAATCTTCTCGAGAAGATTTCATATATCTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011993.2-1323s1c1
Sequence:CCGGCCATAACCTGAATGTAGAGTACTCGAGTACTCTACATTCAGGTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011993.4-1817s21c1
Sequence:CCGGCTCCAACATCACGTCTCTTTCCTCGAGGAAAGAGACGTGATGTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011993.4-1444s21c1
Sequence:CCGGGAGTGCCCACGGTGGTCATAACTCGAGTTATGACCACCGTGGGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011993.4-1039s21c1
Sequence:CCGGCTATCAACCCGGACCCTACTACTCGAGTAGTAGGGTCCGGGTTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011993.4-526s21c1
Sequence:CCGGACTCCTTACATGTGGACATTCCTCGAGGAATGTCCACATGTAAGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011993
DPYSL4 MISSION shRNA Lentiviral Transduction Particles
dihydropyrimidinase-like 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011993.2-1840s1c1
Sequence:CCGGCCTTCCTTTGTAGATTGTTATCTCGAGATAACAATCTACAAAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011993.2-166s1c1
Sequence:CCGGGACGGTCTGATTAAACAAATTCTCGAGAATTTGTTTAATCAGACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011993.2-1555s1c1
Sequence:CCGGCCTGTGCATGAAGTGATGTTACTCGAGTAACATCACTTCATGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011993.2-585s1c1
Sequence:CCGGCGGTCAGATATATGAAATCTTCTCGAGAAGATTTCATATATCTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011993.2-1323s1c1
Sequence:CCGGCCATAACCTGAATGTAGAGTACTCGAGTACTCTACATTCAGGTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011993.4-1817s21c1
Sequence:CCGGCTCCAACATCACGTCTCTTTCCTCGAGGAAAGAGACGTGATGTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011993.4-1444s21c1
Sequence:CCGGGAGTGCCCACGGTGGTCATAACTCGAGTTATGACCACCGTGGGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011993.4-1039s21c1
Sequence:CCGGCTATCAACCCGGACCCTACTACTCGAGTAGTAGGGTCCGGGTTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011993.4-526s21c1
Sequence:CCGGACTCCTTACATGTGGACATTCCTCGAGGAATGTCCACATGTAAGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks