EMAIL THIS PAGE TO A FRIEND

DPYSL5

dihydropyrimidinase-like 5

142 Gene Product Result for
Synonyms: CRAM CRMP-5 CRMP5 Ulip6
UniProtKB ID: Q9BPU6, Q8TCL6, Q9NQC4, Q9NRY9
Gene ID:
Human(56896) Summary: This gene encodes a member of the CRMP (collapsing response mediator protein) family thought to be involved in neural development. Antibodies to the encoded protein were found in some patients with neurologic symptoms who had paraneoplastic syndrome. A pseudogene of this gene is found on chromosome 11. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Dec 2011]
Mouse(65254) dihydropyrimidinase-like 5
Rat(65208) dihydropyrimidinase-like 5
cow(100126171) dihydropyrimidinase-like 5
Horse(100071300) dihydropyrimidinase-like 5
domestic cat(101082052) dihydropyrimidinase-like 5
dog(483004) dihydropyrimidinase-like 5
naked mole-rat(101701192) dihydropyrimidinase-like 5
domestic guinea pig(100725488) dihydropyrimidinase-like 5
sheep(101111869) dihydropyrimidinase-like 5
Domestic Rabbit(100353506) dihydropyrimidinase-like 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023047 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023047 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023047 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020134 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020134 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020134 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121231 MISSION® esiRNA esiRNA human DPYSL5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020134 Rosetta Predictions human pricing
NM_023023 Rosetta Predictions rat pricing
NM_023047 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020134 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245612 predicted 1586
2 SASI_Hs01_00245613 predicted 1299
3 SASI_Hs01_00245614 predicted 924
4 SASI_Hs01_00245615 predicted 1422
5 SASI_Hs01_00245616 predicted 608
6 SASI_Hs01_00245617 predicted 847
7 SASI_Hs01_00245619 predicted 873
8 SASI_Hs01_00245620 predicted 1773
9 SASI_Hs01_00245621 predicted 236
10 SASI_Hs02_00353017 predicted 1333
11 SASI_Hs01_00245618 predicted 1160
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023023 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085417 predicted 719
2 SASI_Rn01_00085418 predicted 895
3 SASI_Rn01_00085419 predicted 838
4 SASI_Rn01_00085420 predicted 1176
5 SASI_Rn01_00085421 predicted 268
6 SASI_Rn01_00085422 predicted 1383
7 SASI_Rn02_00263710 predicted 1258
8 SASI_Rn02_00263711 predicted 1321
9 SASI_Rn01_00085423 predicted 1738
10 SASI_Rn01_00085425 predicted 1798
11 SASI_Rn01_00085424 predicted 814
12 SASI_Rn01_00085426 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023047 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096531 predicted 423
2 SASI_Mm01_00096532 predicted 965
3 SASI_Mm01_00096533 predicted 1543
4 SASI_Mm01_00096534 predicted 872
5 SASI_Mm01_00096535 predicted 1330
6 SASI_Mm01_00096537 predicted 1214
7 SASI_Mm01_00096538 predicted 1053
8 SASI_Mm01_00096539 predicted 1676
9 SASI_Mm01_00096540 predicted 1955
10 SASI_Mm02_00326744 predicted 646
11 SASI_Mm01_00096536 predicted 1996
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023047
DPYSL5 MISSION shRNA Bacterial Glycerol Stock
dihydropyrimidinase-like 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023047.2-750s1c1
Sequence:CCGGCCAGATGTTCATGACCTACAACTCGAGTTGTAGGTCATGAACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023047.2-1234s1c1
Sequence:CCGGCTGAACATTGTGGCATCCGATCTCGAGATCGGATGCCACAATGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023047.2-1011s1c1
Sequence:CCGGCCTGGTCAATGTGTCTAGTATCTCGAGATACTAGACACATTGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023047.2-1680s1c1
Sequence:CCGGCCCAGACATTGTCTATAAGAACTCGAGTTCTTATAGACAATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023047.2-306s1c1
Sequence:CCGGGATTCTCATCAAGGGAGGCAACTCGAGTTGCCTCCCTTGATGAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023047
DPYSL5 MISSION shRNA shRNA Plasmid DNA
dihydropyrimidinase-like 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023047.2-750s1c1
Sequence:CCGGCCAGATGTTCATGACCTACAACTCGAGTTGTAGGTCATGAACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023047.2-1234s1c1
Sequence:CCGGCTGAACATTGTGGCATCCGATCTCGAGATCGGATGCCACAATGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023047.2-1011s1c1
Sequence:CCGGCCTGGTCAATGTGTCTAGTATCTCGAGATACTAGACACATTGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023047.2-1680s1c1
Sequence:CCGGCCCAGACATTGTCTATAAGAACTCGAGTTCTTATAGACAATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023047.2-306s1c1
Sequence:CCGGGATTCTCATCAAGGGAGGCAACTCGAGTTGCCTCCCTTGATGAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023047
DPYSL5 MISSION shRNA Lentiviral Transduction Particles
dihydropyrimidinase-like 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023047.2-750s1c1
Sequence:CCGGCCAGATGTTCATGACCTACAACTCGAGTTGTAGGTCATGAACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023047.2-1234s1c1
Sequence:CCGGCTGAACATTGTGGCATCCGATCTCGAGATCGGATGCCACAATGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023047.2-1011s1c1
Sequence:CCGGCCTGGTCAATGTGTCTAGTATCTCGAGATACTAGACACATTGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023047.2-1680s1c1
Sequence:CCGGCCCAGACATTGTCTATAAGAACTCGAGTTCTTATAGACAATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023047.2-306s1c1
Sequence:CCGGGATTCTCATCAAGGGAGGCAACTCGAGTTGCCTCCCTTGATGAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020134
DPYSL5 MISSION shRNA Bacterial Glycerol Stock
dihydropyrimidinase-like 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020134.2-2028s1c1
Sequence:CCGGGCCAACTCTAACAGGCACTTTCTCGAGAAAGTGCCTGTTAGAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020134.2-1143s1c1
Sequence:CCGGGCCTTTCACCACAAAGCAGAACTCGAGTTCTGCTTTGTGGTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020134.2-873s1c1
Sequence:CCGGCAGGACTCACTGTCCAATCTACTCGAGTAGATTGGACAGTGAGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020134.2-238s1c1
Sequence:CCGGGCTGACGTCTACATCGAGAATCTCGAGATTCTCGATGTAGACGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020134.2-1306s1c1
Sequence:CCGGGCTAAGCTTCTGAACCTGTATCTCGAGATACAGGTTCAGAAGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020134
DPYSL5 MISSION shRNA shRNA Plasmid DNA
dihydropyrimidinase-like 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020134.2-2028s1c1
Sequence:CCGGGCCAACTCTAACAGGCACTTTCTCGAGAAAGTGCCTGTTAGAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020134.2-1143s1c1
Sequence:CCGGGCCTTTCACCACAAAGCAGAACTCGAGTTCTGCTTTGTGGTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020134.2-873s1c1
Sequence:CCGGCAGGACTCACTGTCCAATCTACTCGAGTAGATTGGACAGTGAGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020134.2-238s1c1
Sequence:CCGGGCTGACGTCTACATCGAGAATCTCGAGATTCTCGATGTAGACGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020134.2-1306s1c1
Sequence:CCGGGCTAAGCTTCTGAACCTGTATCTCGAGATACAGGTTCAGAAGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020134
DPYSL5 MISSION shRNA Lentiviral Transduction Particles
dihydropyrimidinase-like 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020134.2-2028s1c1
Sequence:CCGGGCCAACTCTAACAGGCACTTTCTCGAGAAAGTGCCTGTTAGAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020134.2-1143s1c1
Sequence:CCGGGCCTTTCACCACAAAGCAGAACTCGAGTTCTGCTTTGTGGTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020134.2-873s1c1
Sequence:CCGGCAGGACTCACTGTCCAATCTACTCGAGTAGATTGGACAGTGAGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020134.2-238s1c1
Sequence:CCGGGCTGACGTCTACATCGAGAATCTCGAGATTCTCGATGTAGACGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020134.2-1306s1c1
Sequence:CCGGGCTAAGCTTCTGAACCTGTATCTCGAGATACAGGTTCAGAAGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks