EMAIL THIS PAGE TO A FRIEND

DQX1

DEAQ box RNA-dependent ATPase 1

48 Gene Product Result for
UniProtKB ID: Q8TE96, Q6B017, Q8NAM8
Gene ID:
Mouse(93838) DEAQ RNA-dependent ATPase
Rat(680434) DEAQ box RNA-dependent ATPase 1
chicken(100859193) DEAQ box RNA-dependent ATPase 1
domestic cat(101087985) DEAQ box RNA-dependent ATPase 1
dog(475784) DEAQ box RNA-dependent ATPase 1
cow(517947) DEAQ box RNA-dependent ATPase 1
Horse(100069025) DEAQ box RNA-dependent ATPase 1
sheep(101119457) DEAQ box RNA-dependent ATPase 1
Domestic Rabbit(100348381) DEAQ box RNA-dependent ATPase 1
domestic guinea pig(100734627) DEAQ box RNA-dependent ATPase 1
naked mole-rat(101696954) DEAQ box RNA-dependent ATPase 1
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133637 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133637 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133637 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033606 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033606 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033606 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133637 Rosetta Predictions human pricing
NM_001109407 Rosetta Predictions rat pricing
NM_033606 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133637 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066677 predicted 1827
2 SASI_Hs02_00363271 predicted 2134
3 SASI_Hs01_00066678 predicted 1759
4 SASI_Hs01_00066679 predicted 1748
5 SASI_Hs01_00066680 predicted 2351
6 SASI_Hs01_00066683 predicted 815
7 SASI_Hs01_00066684 predicted 1088
8 SASI_Hs01_00066685 predicted 1327
9 SASI_Hs02_00363272 predicted 1824
10 SASI_Hs01_00066686 predicted 1478
11 SASI_Hs01_00066681 predicted 2037
12 SASI_Hs01_00066682 predicted 2067
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109407 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248107 predicted 1030
2 SASI_Rn02_00248108 predicted 2251
3 SASI_Rn02_00248109 predicted 1441
4 SASI_Rn02_00248110 predicted 1712
5 SASI_Rn02_00248111 predicted 1403
6 SASI_Rn02_00248112 predicted 1301
7 SASI_Rn02_00248113 predicted 1653
8 SASI_Rn02_00248114 predicted 610
9 SASI_Rn02_00248115 predicted 2254
10 SASI_Rn02_00248116 predicted 845
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033606 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132479 predicted 801
2 SASI_Mm01_00132480 predicted 1339
3 SASI_Mm02_00337466 predicted 1680
4 SASI_Mm01_00132481 predicted 920
5 SASI_Mm01_00132482 predicted 1962
6 SASI_Mm01_00132484 predicted 1749
7 SASI_Mm01_00132485 predicted 1964
8 SASI_Mm01_00132486 predicted 1993
9 SASI_Mm01_00132487 predicted 1386
10 SASI_Mm01_00132488 predicted 2388
11 SASI_Mm01_00132483 predicted 2496
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133637
DQX1 MISSION shRNA Bacterial Glycerol Stock
DEAQ box RNA-dependent ATPase 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133637.1-2136s1c1
Sequence:CCGGGAACCAGCTAAGGGAAGGAATCTCGAGATTCCTTCCCTTAGCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163264    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133637.1-2248s1c1
Sequence:CCGGGCTGGGTTCATCTCATCACATCTCGAGATGTGATGAGATGAACCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159229    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133637.1-2305s1c1
Sequence:CCGGCAGATTTAGAAGCCCAAAGTTCTCGAGAACTTTGGGCTTCTAAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158743    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133637.1-2253s1c1
Sequence:CCGGGTTCATCTCATCACATTAGATCTCGAGATCTAATGTGATGAGATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133637.1-2007s1c1
Sequence:CCGGCCACAATTTCACCATATCCAACTCGAGTTGGATATGGTGAAATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133637.1-1000s1c1
Sequence:CCGGGCTGTGTATGAGGACATGGATCTCGAGATCCATGTCCTCATACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133637.1-1662s1c1
Sequence:CCGGCCAGGTGTATGAAGCCTTTATCTCGAGATAAAGGCTTCATACACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133637
DQX1 MISSION shRNA shRNA Plasmid DNA
DEAQ box RNA-dependent ATPase 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133637.1-2136s1c1
Sequence:CCGGGAACCAGCTAAGGGAAGGAATCTCGAGATTCCTTCCCTTAGCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163264    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133637.1-2248s1c1
Sequence:CCGGGCTGGGTTCATCTCATCACATCTCGAGATGTGATGAGATGAACCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159229    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133637.1-2305s1c1
Sequence:CCGGCAGATTTAGAAGCCCAAAGTTCTCGAGAACTTTGGGCTTCTAAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158743    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133637.1-2253s1c1
Sequence:CCGGGTTCATCTCATCACATTAGATCTCGAGATCTAATGTGATGAGATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133637.1-2007s1c1
Sequence:CCGGCCACAATTTCACCATATCCAACTCGAGTTGGATATGGTGAAATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133637.1-1000s1c1
Sequence:CCGGGCTGTGTATGAGGACATGGATCTCGAGATCCATGTCCTCATACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133637.1-1662s1c1
Sequence:CCGGCCAGGTGTATGAAGCCTTTATCTCGAGATAAAGGCTTCATACACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133637
DQX1 MISSION shRNA Lentiviral Transduction Particles
DEAQ box RNA-dependent ATPase 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133637.1-2136s1c1
Sequence:CCGGGAACCAGCTAAGGGAAGGAATCTCGAGATTCCTTCCCTTAGCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163264    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133637.1-2248s1c1
Sequence:CCGGGCTGGGTTCATCTCATCACATCTCGAGATGTGATGAGATGAACCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159229    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133637.1-2305s1c1
Sequence:CCGGCAGATTTAGAAGCCCAAAGTTCTCGAGAACTTTGGGCTTCTAAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158743    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133637.1-2253s1c1
Sequence:CCGGGTTCATCTCATCACATTAGATCTCGAGATCTAATGTGATGAGATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133637.1-2007s1c1
Sequence:CCGGCCACAATTTCACCATATCCAACTCGAGTTGGATATGGTGAAATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133637.1-1000s1c1
Sequence:CCGGGCTGTGTATGAGGACATGGATCTCGAGATCCATGTCCTCATACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133637.1-1662s1c1
Sequence:CCGGCCAGGTGTATGAAGCCTTTATCTCGAGATAAAGGCTTCATACACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033606
DQX1 MISSION shRNA Bacterial Glycerol Stock
DEAQ box RNA-dependent ATPase 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000257791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033606.3-2212s21c1
Sequence:CCGGATCTGCTTCTCACCCATAAACCTCGAGGTTTATGGGTGAGAAGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033606.3-2762s21c1
Sequence:CCGGTCTCCTTGGTGAGACTATAAACTCGAGTTTATAGTCTCACCAAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033606.3-1759s21c1
Sequence:CCGGGAGTGATCCTGTCGGAGTTTCCTCGAGGAAACTCCGACAGGATCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033606.3-1340s21c1
Sequence:CCGGCACTCATTGGCTGGCCGATTTCTCGAGAAATCGGCCAGCCAATGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033606
DQX1 MISSION shRNA shRNA Plasmid DNA
DEAQ box RNA-dependent ATPase 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000257791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033606.3-2212s21c1
Sequence:CCGGATCTGCTTCTCACCCATAAACCTCGAGGTTTATGGGTGAGAAGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033606.3-2762s21c1
Sequence:CCGGTCTCCTTGGTGAGACTATAAACTCGAGTTTATAGTCTCACCAAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033606.3-1759s21c1
Sequence:CCGGGAGTGATCCTGTCGGAGTTTCCTCGAGGAAACTCCGACAGGATCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033606.3-1340s21c1
Sequence:CCGGCACTCATTGGCTGGCCGATTTCTCGAGAAATCGGCCAGCCAATGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033606
DQX1 MISSION shRNA Lentiviral Transduction Particles
DEAQ box RNA-dependent ATPase 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000257791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033606.3-2212s21c1
Sequence:CCGGATCTGCTTCTCACCCATAAACCTCGAGGTTTATGGGTGAGAAGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033606.3-2762s21c1
Sequence:CCGGTCTCCTTGGTGAGACTATAAACTCGAGTTTATAGTCTCACCAAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033606.3-1759s21c1
Sequence:CCGGGAGTGATCCTGTCGGAGTTTCCTCGAGGAAACTCCGACAGGATCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033606.3-1340s21c1
Sequence:CCGGCACTCATTGGCTGGCCGATTTCTCGAGAAATCGGCCAGCCAATGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks