EMAIL THIS PAGE TO A FRIEND

DR1

down-regulator of transcription 1, TBP-binding (negative cofactor 2)

Synonyms: NC2 NC2-BETA
UniProtKB ID: Q01658
Gene ID:
Human(1810) Summary: This gene encodes a TBP- (TATA box-binding protein) associated phosphoprotein that represses both basal and activated levels of transcription. The encoded protein is phosphorylated in vivo and this phosphorylation affects its interaction with TBP. This protein contains a histone fold motif at the amino terminus, a TBP-binding domain, and a glutamine- and alanine-rich region. The binding of DR1 repressor complexes to TBP-promoter complexes may establish a mechanism in which an altered DNA conformation, together with the formation of higher order complexes, inhibits the assembly of the preinitiation complex and controls the rate of RNA polymerase II transcription. [provided by RefSeq, Jul 2008]
Mouse(13486) down-regulator of transcription 1
Rat(289881) down-regulator of transcription 1
Zebrafish(768171) down-regulator of transcription 1
cow(613828) down-regulator of transcription 1, TBP-binding (negative cofactor 2)
chicken(424496) down-regulator of transcription 1, TBP-binding (negative cofactor 2)
domestic cat(101098807) down-regulator of transcription 1, TBP-binding (negative cofactor 2)
dog(479943) down-regulator of transcription 1, TBP-binding (negative cofactor 2)
naked mole-rat(101707064) down-regulator of transcription 1, TBP-binding (negative cofactor 2)
domestic guinea pig(100724062) down-regulator of transcription 1, TBP-binding (negative cofactor 2)
sheep(101105865) down-regulator of transcription 1, TBP-binding (negative cofactor 2)
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001938 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001938 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001938 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026106 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026106 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026106 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001938 Rosetta Predictions human pricing
NM_001011914 Rosetta Predictions rat pricing
XM_573543 Rosetta Predictions rat pricing
NM_026106 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001938 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085714 predicted 840
2 SASI_Hs01_00085715 predicted 982
3 SASI_Hs01_00085717 predicted 740
4 SASI_Hs01_00085718 predicted 927
5 SASI_Hs02_00332841 predicted 882
6 SASI_Hs01_00085719 predicted 1082
7 SASI_Hs02_00332842 predicted 1081
8 SASI_Hs02_00332843 predicted 962
9 SASI_Hs01_00085721 predicted 782
10 SASI_Hs02_00332844 predicted 850
11 SASI_Hs01_00085713 predicted 1319
12 SASI_Hs01_00085716 predicted 966
13 SASI_Hs01_00085720 predicted 850
14 SASI_Hs01_00085722 predicted 1240
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011914 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068959 predicted 731
2 SASI_Rn01_00068961 predicted 1251
3 SASI_Rn01_00068962 predicted 1254
4 SASI_Rn01_00068963 predicted 1232
5 SASI_Rn01_00068964 predicted 1380
6 SASI_Rn02_00199910 predicted 1428
7 SASI_Rn01_00068965 predicted 1435
8 SASI_Rn01_00068967 predicted 749
9 SASI_Rn02_00199911 predicted 1245
10 SASI_Rn01_00068968 predicted 1205
11 SASI_Rn01_00068960 predicted 690
12 SASI_Rn01_00068966 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573543 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00161728 predicted 736
2 SASI_Rn01_00161729 predicted 685
3 SASI_Rn01_00161730 predicted 1252
4 SASI_Rn01_00161731 predicted 1255
5 SASI_Rn01_00161732 predicted 1238
6 SASI_Rn01_00161733 predicted 1382
7 SASI_Rn01_00161734 predicted 1438
8 SASI_Rn01_00161735 predicted 672
9 SASI_Rn01_00161736 predicted 753
10 SASI_Rn01_00161737 predicted 1215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026106 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113095 predicted 1169
2 SASI_Mm01_00113096 predicted 1248
3 SASI_Mm01_00113097 predicted 805
4 SASI_Mm01_00113098 predicted 817
5 SASI_Mm01_00113099 predicted 1221
6 SASI_Mm01_00113100 predicted 1280
7 SASI_Mm01_00113101 predicted 818
8 SASI_Mm01_00113102 predicted 857
9 SASI_Mm01_00113103 predicted 1259
10 SASI_Mm01_00113104 predicted 1085
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001938
DR1 MISSION shRNA Bacterial Glycerol Stock
down-regulator of transcription 1, TBP-binding (negative cofactor 2)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001938.2-1191s21c1
Sequence:CCGGGCCTCAGCCAGTGCATCTAATCTCGAGATTAGATGCACTGGCTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001938.2-765s21c1
Sequence:CCGGCCCAGAGCTGCTATCAATAAACTCGAGTTTATTGATAGCAGCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425637    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001938.2-1355s21c1
Sequence:CCGGGTGGACTTGTCATTGGTATTCCTCGAGGAATACCAATGACAAGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001938.2-990s21c1
Sequence:CCGGGAAGTCTTGCAAGAGTGTAAACTCGAGTTTACACTCTTGCAAGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001938.2-1516s21c1
Sequence:CCGGAGTCCTTCGTTTGATCAATAACTCGAGTTATTGATCAAACGAAGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001938.2-2375s1c1
Sequence:CCGGGCCCTATATGAATTAACTGATCTCGAGATCAGTTAATTCATATAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001938.2-933s1c1
Sequence:CCGGCATGTCATACAAGCACTAGAACTCGAGTTCTAGTGCTTGTATGACATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001938.2-1071s1c1
Sequence:CCGGGAAGAGTTATTGAGACAGCAACTCGAGTTGCTGTCTCAATAACTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001938.2-885s1c1
Sequence:CCGGGCCAATGAGATTTGTAACAAACTCGAGTTTGTTACAAATCTCATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001938.2-869s1c1
Sequence:CCGGCCTTATATCTTCTGAAGCCAACTCGAGTTGGCTTCAGAAGATATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001938
DR1 MISSION shRNA shRNA Plasmid DNA
down-regulator of transcription 1, TBP-binding (negative cofactor 2)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001938.2-1191s21c1
Sequence:CCGGGCCTCAGCCAGTGCATCTAATCTCGAGATTAGATGCACTGGCTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001938.2-765s21c1
Sequence:CCGGCCCAGAGCTGCTATCAATAAACTCGAGTTTATTGATAGCAGCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425637    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001938.2-1355s21c1
Sequence:CCGGGTGGACTTGTCATTGGTATTCCTCGAGGAATACCAATGACAAGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001938.2-990s21c1
Sequence:CCGGGAAGTCTTGCAAGAGTGTAAACTCGAGTTTACACTCTTGCAAGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001938.2-1516s21c1
Sequence:CCGGAGTCCTTCGTTTGATCAATAACTCGAGTTATTGATCAAACGAAGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001938.2-2375s1c1
Sequence:CCGGGCCCTATATGAATTAACTGATCTCGAGATCAGTTAATTCATATAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001938.2-933s1c1
Sequence:CCGGCATGTCATACAAGCACTAGAACTCGAGTTCTAGTGCTTGTATGACATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001938.2-1071s1c1
Sequence:CCGGGAAGAGTTATTGAGACAGCAACTCGAGTTGCTGTCTCAATAACTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001938.2-885s1c1
Sequence:CCGGGCCAATGAGATTTGTAACAAACTCGAGTTTGTTACAAATCTCATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001938.2-869s1c1
Sequence:CCGGCCTTATATCTTCTGAAGCCAACTCGAGTTGGCTTCAGAAGATATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001938
DR1 MISSION shRNA Lentiviral Transduction Particles
down-regulator of transcription 1, TBP-binding (negative cofactor 2)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001938.2-1191s21c1
Sequence:CCGGGCCTCAGCCAGTGCATCTAATCTCGAGATTAGATGCACTGGCTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001938.2-765s21c1
Sequence:CCGGCCCAGAGCTGCTATCAATAAACTCGAGTTTATTGATAGCAGCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425637    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001938.2-1355s21c1
Sequence:CCGGGTGGACTTGTCATTGGTATTCCTCGAGGAATACCAATGACAAGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001938.2-990s21c1
Sequence:CCGGGAAGTCTTGCAAGAGTGTAAACTCGAGTTTACACTCTTGCAAGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001938.2-1516s21c1
Sequence:CCGGAGTCCTTCGTTTGATCAATAACTCGAGTTATTGATCAAACGAAGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001938.2-2375s1c1
Sequence:CCGGGCCCTATATGAATTAACTGATCTCGAGATCAGTTAATTCATATAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001938.2-933s1c1
Sequence:CCGGCATGTCATACAAGCACTAGAACTCGAGTTCTAGTGCTTGTATGACATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001938.2-1071s1c1
Sequence:CCGGGAAGAGTTATTGAGACAGCAACTCGAGTTGCTGTCTCAATAACTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001938.2-885s1c1
Sequence:CCGGGCCAATGAGATTTGTAACAAACTCGAGTTTGTTACAAATCTCATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001938.2-869s1c1
Sequence:CCGGCCTTATATCTTCTGAAGCCAACTCGAGTTGGCTTCAGAAGATATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026106
VALIDATED
DR1 MISSION shRNA Bacterial Glycerol Stock
down-regulator of transcription 1, TBP-binding (negative cofactor 2)
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374046    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026106.4-1293s21c1
Sequence:CCGGGTGGACTTACCATTGGTATTCCTCGAGGAATACCAATGGTAAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026106.4-936s21c1
Sequence:CCGGCTCTTACATCAGTGAAGTAAACTCGAGTTTACTTCACTGATGTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026106.4-758s21c1
Sequence:GTACCGGTCAAAGAGACTCTTCCTAATGCTCGAGCATTAGGAAGAGTCTCTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026106.4-970s21c1
Sequence:GTACCGGGAATGCAAGACAGTAGCATTACTCGAGTAATGCTACTGTCTTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026106.4-890s21c1
Sequence:CCGGTTTCACCAGAGCATGTTATACCTCGAGGTATAACATGCTCTGGTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026106.4-846s21c1
Sequence:CCGGTTCTGAAGCCAACGAGATTTGCTCGAGCAAATCTCGTTGGCTTCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026106.4-2293s21c1
Sequence:CCGGTCATAACTGCAGCCCTATATGCTCGAGCATATAGGGCTGCAGTTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026106.3-2194s1c1
Sequence:CCGGGCCTAAAGAATCCAATGCTAACTCGAGTTAGCATTGGATTCTTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026106.3-824s1c1
Sequence:CCGGCGGAATTCATTCACCTTATATCTCGAGATATAAGGTGAATGAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026106.3-821s1c1
Sequence:CCGGGCACGGAATTCATTCACCTTACTCGAGTAAGGTGAATGAATTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026106.3-1026s1c1
Sequence:CCGGCGGCATTCCTGAAGAGGAATTCTCGAGAATTCCTCTTCAGGAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026106.3-1028s1c1
Sequence:CCGGGCATTCCTGAAGAGGAATTATCTCGAGATAATTCCTCTTCAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026106
VALIDATED
DR1 MISSION shRNA shRNA Plasmid DNA
down-regulator of transcription 1, TBP-binding (negative cofactor 2)
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374046    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026106.4-1293s21c1
Sequence:CCGGGTGGACTTACCATTGGTATTCCTCGAGGAATACCAATGGTAAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026106.4-936s21c1
Sequence:CCGGCTCTTACATCAGTGAAGTAAACTCGAGTTTACTTCACTGATGTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026106.4-758s21c1
Sequence:GTACCGGTCAAAGAGACTCTTCCTAATGCTCGAGCATTAGGAAGAGTCTCTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026106.4-970s21c1
Sequence:GTACCGGGAATGCAAGACAGTAGCATTACTCGAGTAATGCTACTGTCTTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026106.4-890s21c1
Sequence:CCGGTTTCACCAGAGCATGTTATACCTCGAGGTATAACATGCTCTGGTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026106.4-846s21c1
Sequence:CCGGTTCTGAAGCCAACGAGATTTGCTCGAGCAAATCTCGTTGGCTTCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026106.4-2293s21c1
Sequence:CCGGTCATAACTGCAGCCCTATATGCTCGAGCATATAGGGCTGCAGTTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026106.3-2194s1c1
Sequence:CCGGGCCTAAAGAATCCAATGCTAACTCGAGTTAGCATTGGATTCTTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026106.3-824s1c1
Sequence:CCGGCGGAATTCATTCACCTTATATCTCGAGATATAAGGTGAATGAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026106.3-821s1c1
Sequence:CCGGGCACGGAATTCATTCACCTTACTCGAGTAAGGTGAATGAATTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026106.3-1026s1c1
Sequence:CCGGCGGCATTCCTGAAGAGGAATTCTCGAGAATTCCTCTTCAGGAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026106.3-1028s1c1
Sequence:CCGGGCATTCCTGAAGAGGAATTATCTCGAGATAATTCCTCTTCAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026106
VALIDATED
DR1 MISSION shRNA Lentiviral Transduction Particles
down-regulator of transcription 1, TBP-binding (negative cofactor 2)
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374046    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026106.4-1293s21c1
Sequence:CCGGGTGGACTTACCATTGGTATTCCTCGAGGAATACCAATGGTAAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026106.4-936s21c1
Sequence:CCGGCTCTTACATCAGTGAAGTAAACTCGAGTTTACTTCACTGATGTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026106.4-758s21c1
Sequence:GTACCGGTCAAAGAGACTCTTCCTAATGCTCGAGCATTAGGAAGAGTCTCTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026106.4-970s21c1
Sequence:GTACCGGGAATGCAAGACAGTAGCATTACTCGAGTAATGCTACTGTCTTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026106.4-890s21c1
Sequence:CCGGTTTCACCAGAGCATGTTATACCTCGAGGTATAACATGCTCTGGTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026106.4-846s21c1
Sequence:CCGGTTCTGAAGCCAACGAGATTTGCTCGAGCAAATCTCGTTGGCTTCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026106.4-2293s21c1
Sequence:CCGGTCATAACTGCAGCCCTATATGCTCGAGCATATAGGGCTGCAGTTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026106.3-2194s1c1
Sequence:CCGGGCCTAAAGAATCCAATGCTAACTCGAGTTAGCATTGGATTCTTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026106.3-824s1c1
Sequence:CCGGCGGAATTCATTCACCTTATATCTCGAGATATAAGGTGAATGAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026106.3-821s1c1
Sequence:CCGGGCACGGAATTCATTCACCTTACTCGAGTAAGGTGAATGAATTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026106.3-1026s1c1
Sequence:CCGGCGGCATTCCTGAAGAGGAATTCTCGAGAATTCCTCTTCAGGAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026106.3-1028s1c1
Sequence:CCGGGCATTCCTGAAGAGGAATTATCTCGAGATAATTCCTCTTCAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks