EMAIL THIS PAGE TO A FRIEND

DRAM1

DNA-damage regulated autophagy modulator 1

134 Gene Product Result for
Synonyms: DRAM
UniProtKB ID: Q8N682, Q7L3E3, Q9NUN1
Gene ID:
Human(55332) Summary: This gene is regulated as part of the p53 tumor suppressor pathway. The gene encodes a lysosomal membrane protein that is required for the induction of autophagy by the pathway. Decreased transcriptional expression of this gene is associated with various tumors. This gene has a pseudogene on chromosome 4. [provided by RefSeq, Jul 2008]
Mouse(71712) DNA-damage regulated autophagy modulator 1
Rat(679937) DNA-damage regulated autophagy modulator 1
Zebrafish(450028) DNA-damage regulated autophagy modulator 1
cow(533992) DNA-damage regulated autophagy modulator 1
dog(612179) DNA-damage regulated autophagy modulator 1
domestic cat(101081234) DNA-damage regulated autophagy modulator 1
chicken(418095) DNA-damage regulated autophagy modulator 1
sheep(101109084) DNA-damage regulated autophagy modulator 1
domestic guinea pig(100718424) DNA-damage regulated autophagy modulator 1
naked mole-rat(101710175) DNA-damage regulated autophagy modulator 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018370 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018370 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018370 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027878 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027878 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027878 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018370 Rosetta Predictions human pricing
XM_001055011 Rosetta Predictions rat pricing
NM_027878 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018370 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218923 predicted 1106
2 SASI_Hs01_00218924 predicted 1033
3 SASI_Hs02_00351842 predicted 1148
4 SASI_Hs01_00218927 predicted 1139
5 SASI_Hs02_00351843 predicted 709
6 SASI_Hs02_00351844 predicted 592
7 SASI_Hs02_00351845 predicted 1204
8 SASI_Hs02_00351846 predicted 627
9 SASI_Hs02_00351847 predicted 581
10 SASI_Hs02_00351848 predicted 712
11 SASI_Hs01_00218922 predicted 459
12 SASI_Hs01_00218925 predicted 458
13 SASI_Hs01_00218926 predicted 444
14 SASI_Hs01_00218928 predicted 444
15 SASI_Hs01_00218929 predicted 236
16 SASI_Hs01_00218930 predicted 267
17 SASI_Hs01_00218931 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055011 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278072 predicted 614
2 SASI_Rn02_00278073 predicted 724
3 SASI_Rn02_00278074 predicted 998
4 SASI_Rn02_00278075 predicted 691
5 SASI_Rn02_00278076 predicted 649
6 SASI_Rn02_00278077 predicted 767
7 SASI_Rn02_00278078 predicted 621
8 SASI_Rn02_00278079 predicted 954
9 SASI_Rn02_00278080 predicted 870
10 SASI_Rn02_00278081 predicted 751
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027878 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173695 predicted 832
2 SASI_Mm01_00173696 predicted 999
3 SASI_Mm01_00173697 predicted 338
4 SASI_Mm02_00332839 predicted 956
5 SASI_Mm01_00173698 predicted 567
6 SASI_Mm01_00173699 predicted 830
7 SASI_Mm01_00173700 predicted 511
8 SASI_Mm01_00173701 predicted 685
9 SASI_Mm01_00173702 predicted 1151
10 SASI_Mm01_00173704 predicted 362
11 SASI_Mm01_00173703 predicted 328
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018370
VALIDATED
DRAM1 MISSION shRNA Bacterial Glycerol Stock
DNA-damage regulated autophagy modulator 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000186838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018370.1-1893s1c1
Sequence:CCGGGCCCTTTAATAAAGCCAAGTACTCGAGTACTTGGCTTTATTAAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018370.1-183s1c1
Sequence:CCGGCCTACAGTCCATCATCTCTTACTCGAGTAAGAGATGATGGACTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018370.1-2634s1c1
Sequence:CCGGCGTGCCTTAATCTTTATCTTTCTCGAGAAAGATAAAGATTAAGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018370.1-450s1c1
Sequence:CCGGCCTAAGGATATCCACAGAAATCTCGAGATTTCTGTGGATATCCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018370.1-1356s1c1
Sequence:CCGGCGAGACAAGAAGAATGGAGAACTCGAGTTCTCCATTCTTCTTGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018370
VALIDATED
DRAM1 MISSION shRNA shRNA Plasmid DNA
DNA-damage regulated autophagy modulator 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000186838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018370.1-1893s1c1
Sequence:CCGGGCCCTTTAATAAAGCCAAGTACTCGAGTACTTGGCTTTATTAAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018370.1-183s1c1
Sequence:CCGGCCTACAGTCCATCATCTCTTACTCGAGTAAGAGATGATGGACTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018370.1-2634s1c1
Sequence:CCGGCGTGCCTTAATCTTTATCTTTCTCGAGAAAGATAAAGATTAAGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018370.1-450s1c1
Sequence:CCGGCCTAAGGATATCCACAGAAATCTCGAGATTTCTGTGGATATCCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018370.1-1356s1c1
Sequence:CCGGCGAGACAAGAAGAATGGAGAACTCGAGTTCTCCATTCTTCTTGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018370
VALIDATED
DRAM1 MISSION shRNA Lentiviral Transduction Particles
DNA-damage regulated autophagy modulator 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000186838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018370.1-1893s1c1
Sequence:CCGGGCCCTTTAATAAAGCCAAGTACTCGAGTACTTGGCTTTATTAAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018370.1-183s1c1
Sequence:CCGGCCTACAGTCCATCATCTCTTACTCGAGTAAGAGATGATGGACTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018370.1-2634s1c1
Sequence:CCGGCGTGCCTTAATCTTTATCTTTCTCGAGAAAGATAAAGATTAAGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018370.1-450s1c1
Sequence:CCGGCCTAAGGATATCCACAGAAATCTCGAGATTTCTGTGGATATCCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018370.1-1356s1c1
Sequence:CCGGCGAGACAAGAAGAATGGAGAACTCGAGTTCTCCATTCTTCTTGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027878
VALIDATED
DRAM1 MISSION shRNA Bacterial Glycerol Stock
DNA-damage regulated autophagy modulator 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027878.1-822s1c1
Sequence:CCGGCCAGAGTGTCACTCTAAGGATCTCGAGATCCTTAGAGTGACACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027878.1-570s1c1
Sequence:CCGGGCAATCGATCATCTCCTACAACTCGAGTTGTAGGAGATGATCGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027878.1-681s1c1
Sequence:CCGGCTGTGCTTCACTCATTTCTATCTCGAGATAGAAATGAGTGAAGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027878.1-705s1c1
Sequence:CCGGCAAGCTGGAATGGAATCCAAACTCGAGTTTGGATTCCATTCCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027878.2-822s21c1
Sequence:CCGGCCAGAGTGTCACTCTAAGGATCTCGAGATCCTTAGAGTGACACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027878.2-573s21c1
Sequence:CCGGATCGATCATCTCCTACAAATCCTCGAGGATTTGTAGGAGATGATCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027878.2-329s21c1
Sequence:CCGGTGATAAACTTCTCTGCATTTCCTCGAGGAAATGCAGAGAAGTTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027878.2-677s21c1
Sequence:CCGGTTGCCTGTGCTTCACTCATTTCTCGAGAAATGAGTGAAGCACAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027878.2-1348s21c1
Sequence:CCGGTAGTGATTATATACCCTAATGCTCGAGCATTAGGGTATATAATCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027878
VALIDATED
DRAM1 MISSION shRNA shRNA Plasmid DNA
DNA-damage regulated autophagy modulator 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027878.1-822s1c1
Sequence:CCGGCCAGAGTGTCACTCTAAGGATCTCGAGATCCTTAGAGTGACACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027878.1-570s1c1
Sequence:CCGGGCAATCGATCATCTCCTACAACTCGAGTTGTAGGAGATGATCGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027878.1-681s1c1
Sequence:CCGGCTGTGCTTCACTCATTTCTATCTCGAGATAGAAATGAGTGAAGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027878.1-705s1c1
Sequence:CCGGCAAGCTGGAATGGAATCCAAACTCGAGTTTGGATTCCATTCCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027878.2-822s21c1
Sequence:CCGGCCAGAGTGTCACTCTAAGGATCTCGAGATCCTTAGAGTGACACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027878.2-573s21c1
Sequence:CCGGATCGATCATCTCCTACAAATCCTCGAGGATTTGTAGGAGATGATCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027878.2-329s21c1
Sequence:CCGGTGATAAACTTCTCTGCATTTCCTCGAGGAAATGCAGAGAAGTTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027878.2-677s21c1
Sequence:CCGGTTGCCTGTGCTTCACTCATTTCTCGAGAAATGAGTGAAGCACAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027878.2-1348s21c1
Sequence:CCGGTAGTGATTATATACCCTAATGCTCGAGCATTAGGGTATATAATCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027878
VALIDATED
DRAM1 MISSION shRNA Lentiviral Transduction Particles
DNA-damage regulated autophagy modulator 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027878.1-822s1c1
Sequence:CCGGCCAGAGTGTCACTCTAAGGATCTCGAGATCCTTAGAGTGACACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027878.1-570s1c1
Sequence:CCGGGCAATCGATCATCTCCTACAACTCGAGTTGTAGGAGATGATCGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027878.1-681s1c1
Sequence:CCGGCTGTGCTTCACTCATTTCTATCTCGAGATAGAAATGAGTGAAGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027878.1-705s1c1
Sequence:CCGGCAAGCTGGAATGGAATCCAAACTCGAGTTTGGATTCCATTCCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027878.2-822s21c1
Sequence:CCGGCCAGAGTGTCACTCTAAGGATCTCGAGATCCTTAGAGTGACACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027878.2-573s21c1
Sequence:CCGGATCGATCATCTCCTACAAATCCTCGAGGATTTGTAGGAGATGATCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027878.2-329s21c1
Sequence:CCGGTGATAAACTTCTCTGCATTTCCTCGAGGAAATGCAGAGAAGTTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027878.2-677s21c1
Sequence:CCGGTTGCCTGTGCTTCACTCATTTCTCGAGAAATGAGTGAAGCACAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027878.2-1348s21c1
Sequence:CCGGTAGTGATTATATACCCTAATGCTCGAGCATTAGGGTATATAATCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks