EMAIL THIS PAGE TO A FRIEND

DRAP1

DR1-associated protein 1 (negative cofactor 2 alpha)

50 Gene Product Result for
Synonyms: NC2-alpha
UniProtKB ID: Q14919, Q13448
Gene ID:
Human(10589) Summary: Transcriptional repression is a general mechanism for regulating transcriptional initiation in organisms ranging from yeast to humans. Accurate initiation of transcription from eukaryotic protein-encoding genes requires the assembly of a large multiprotein complex consisting of RNA polymerase II and general transcription factors such as TFIIA, TFIIB, and TFIID. DR1 is a repressor that interacts with the TATA-binding protein (TBP) of TFIID and prevents the formation of an active transcription complex by precluding the entry of TFIIA and/or TFIIB into the preinitiation complex. The protein encoded by this gene is a corepressor of transcription that interacts with DR1 to enhance DR1-mediated repression. The interaction between this corepressor and DR1 is required for corepressor function and appears to stabilize the TBP-DR1-DNA complex. [provided by RefSeq, Jul 2008]
Mouse(66556) Dr1 associated protein 1 (negative cofactor 2 alpha)
Rat(293674) Dr1 associated protein 1 (negative cofactor 2 alpha)
Zebrafish(321681) DR1-associated protein 1 (negative cofactor 2 alpha)
dog(476018) DR1-associated protein 1 (negative cofactor 2 alpha)
domestic cat(101101589) DR1-associated protein 1 (negative cofactor 2 alpha)
cow(540345) DR1-associated protein 1 (negative cofactor 2 alpha)
Goat(100861124) DR1-associated protein 1 (negative cofactor 2 alpha)
sheep(101111673) DR1-associated protein 1 (negative cofactor 2 alpha)
domestic guinea pig(100734988) DR1-associated protein 1 (negative cofactor 2 alpha)
naked mole-rat(101706865) DR1-associated protein 1 (negative cofactor 2 alpha)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA006790 Anti-DRAP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2104800 Anti-DRAP1, (N-terminal) antibody produced in rabbit affinity isolated antibody horse, rabbit, human, mouse, rat, guinea pig
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024176 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024176 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024176 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006442 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006442 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006442 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006442 Rosetta Predictions human pricing
NM_001077668 Rosetta Predictions rat pricing
NM_024176 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201367 predicted 663
2 SASI_Hs01_00201368 predicted 458
3 SASI_Hs01_00201369 predicted 500
4 SASI_Hs01_00201370 predicted 377
5 SASI_Hs01_00201371 predicted 470
6 SASI_Hs01_00201372 predicted 398
7 SASI_Hs01_00201373 predicted 287
8 SASI_Hs01_00201374 predicted 437
9 SASI_Hs01_00201375 predicted 656
10 SASI_Hs01_00201376 predicted 631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077668 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207802 predicted 433
2 SASI_Rn02_00207803 predicted 229
3 SASI_Rn02_00207804 predicted 622
4 SASI_Rn02_00207805 predicted 423
5 SASI_Rn02_00207806 predicted 419
6 SASI_Rn02_00207807 predicted 1178
7 SASI_Rn02_00207808 predicted 430
8 SASI_Rn02_00207809 predicted 1121
9 SASI_Rn02_00207810 predicted 554
10 SASI_Rn02_00207811 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024176 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125580 predicted 616
2 SASI_Mm01_00125581 predicted 619
3 SASI_Mm01_00125582 predicted 429
4 SASI_Mm01_00125584 predicted 566
5 SASI_Mm01_00125585 predicted 410
6 SASI_Mm01_00125586 predicted 399
7 SASI_Mm01_00125587 predicted 453
8 SASI_Mm02_00327494 predicted 403
9 SASI_Mm01_00125588 predicted 415
10 SASI_Mm02_00327495 predicted 623
11 SASI_Mm01_00125579 predicted 684
12 SASI_Mm01_00125583 predicted 691
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024176
VALIDATED
DRAP1 MISSION shRNA Bacterial Glycerol Stock
DR1-associated protein 1 (negative cofactor 2 alpha)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024176.1-723s1c1
Sequence:CCGGCTCCCTTCATACCCTTCACATCTCGAGATGTGAAGGGTATGAAGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024176.1-409s1c1
Sequence:CCGGCCTGAAGCAGTGCATTGAACTCTCGAGAGTTCAATGCACTGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024176.1-434s1c1
Sequence:CCGGCAGCAGTTTGACTTCTTGAAACTCGAGTTTCAAGAAGTCAAACTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024176.1-342s1c1
Sequence:CCGGAGTCCCTGTTGAAGAAGGCTTCTCGAGAAGCCTTCTTCAACAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024176.1-631s1c1
Sequence:CCGGGTCTGAGGATACAGATACTGACTCGAGTCAGTATCTGTATCCTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024176.1-262s21c1
Sequence:CCGGCATGCAGACGGACGAAGAGATCTCGAGATCTCTTCGTCCGTCTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024176.1-342s21c1
Sequence:CCGGAGTCCCTGTTGAAGAAGGCTTCTCGAGAAGCCTTCTTCAACAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024176.1-409s21c1
Sequence:CCGGCCTGAAGCAGTGCATTGAACTCTCGAGAGTTCAATGCACTGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024176.1-434s21c1
Sequence:CCGGCAGCAGTTTGACTTCTTGAAACTCGAGTTTCAAGAAGTCAAACTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024176
VALIDATED
DRAP1 MISSION shRNA shRNA Plasmid DNA
DR1-associated protein 1 (negative cofactor 2 alpha)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024176.1-723s1c1
Sequence:CCGGCTCCCTTCATACCCTTCACATCTCGAGATGTGAAGGGTATGAAGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024176.1-409s1c1
Sequence:CCGGCCTGAAGCAGTGCATTGAACTCTCGAGAGTTCAATGCACTGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024176.1-434s1c1
Sequence:CCGGCAGCAGTTTGACTTCTTGAAACTCGAGTTTCAAGAAGTCAAACTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024176.1-342s1c1
Sequence:CCGGAGTCCCTGTTGAAGAAGGCTTCTCGAGAAGCCTTCTTCAACAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024176.1-631s1c1
Sequence:CCGGGTCTGAGGATACAGATACTGACTCGAGTCAGTATCTGTATCCTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024176.1-262s21c1
Sequence:CCGGCATGCAGACGGACGAAGAGATCTCGAGATCTCTTCGTCCGTCTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024176.1-342s21c1
Sequence:CCGGAGTCCCTGTTGAAGAAGGCTTCTCGAGAAGCCTTCTTCAACAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024176.1-409s21c1
Sequence:CCGGCCTGAAGCAGTGCATTGAACTCTCGAGAGTTCAATGCACTGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024176.1-434s21c1
Sequence:CCGGCAGCAGTTTGACTTCTTGAAACTCGAGTTTCAAGAAGTCAAACTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024176
VALIDATED
DRAP1 MISSION shRNA Lentiviral Transduction Particles
DR1-associated protein 1 (negative cofactor 2 alpha)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024176.1-723s1c1
Sequence:CCGGCTCCCTTCATACCCTTCACATCTCGAGATGTGAAGGGTATGAAGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024176.1-409s1c1
Sequence:CCGGCCTGAAGCAGTGCATTGAACTCTCGAGAGTTCAATGCACTGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024176.1-434s1c1
Sequence:CCGGCAGCAGTTTGACTTCTTGAAACTCGAGTTTCAAGAAGTCAAACTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024176.1-342s1c1
Sequence:CCGGAGTCCCTGTTGAAGAAGGCTTCTCGAGAAGCCTTCTTCAACAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024176.1-631s1c1
Sequence:CCGGGTCTGAGGATACAGATACTGACTCGAGTCAGTATCTGTATCCTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024176.1-262s21c1
Sequence:CCGGCATGCAGACGGACGAAGAGATCTCGAGATCTCTTCGTCCGTCTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024176.1-342s21c1
Sequence:CCGGAGTCCCTGTTGAAGAAGGCTTCTCGAGAAGCCTTCTTCAACAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024176.1-409s21c1
Sequence:CCGGCCTGAAGCAGTGCATTGAACTCTCGAGAGTTCAATGCACTGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024176.1-434s21c1
Sequence:CCGGCAGCAGTTTGACTTCTTGAAACTCGAGTTTCAAGAAGTCAAACTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006442
VALIDATED
DRAP1 MISSION shRNA Bacterial Glycerol Stock
DR1-associated protein 1 (negative cofactor 2 alpha)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006442.2-825s1c1
Sequence:CCGGGCACCTGATGAAGAGGACGAACTCGAGTTCGTCCTCTTCATCAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006442.2-377s1c1
Sequence:CCGGCTTCCTAGAGTCGCTGTTGAACTCGAGTTCAACAGCGACTCTAGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006442.2-779s1c1
Sequence:CCGGCTTCGCCTCTACTCTGCCTTTCTCGAGAAAGGCAGAGTAGAGGCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006442.2-311s1c1
Sequence:CCGGGACGGACGAAGAGATTGGGAACTCGAGTTCCCAATCTCTTCGTCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006442.2-664s1c1
Sequence:CCGGAGGAGGATGAATCTGAGGACACTCGAGTGTCCTCAGATTCATCCTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006442.2-779s21c1
Sequence:CCGGCTTCGCCTCTACTCTGCCTTTCTCGAGAAAGGCAGAGTAGAGGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006442.2-377s21c1
Sequence:CCGGCTTCCTAGAGTCGCTGTTGAACTCGAGTTCAACAGCGACTCTAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006442.2-825s21c1
Sequence:CCGGGCACCTGATGAAGAGGACGAACTCGAGTTCGTCCTCTTCATCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006442.2-664s21c1
Sequence:CCGGAGGAGGATGAATCTGAGGACACTCGAGTGTCCTCAGATTCATCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006442
VALIDATED
DRAP1 MISSION shRNA shRNA Plasmid DNA
DR1-associated protein 1 (negative cofactor 2 alpha)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006442.2-825s1c1
Sequence:CCGGGCACCTGATGAAGAGGACGAACTCGAGTTCGTCCTCTTCATCAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006442.2-377s1c1
Sequence:CCGGCTTCCTAGAGTCGCTGTTGAACTCGAGTTCAACAGCGACTCTAGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006442.2-779s1c1
Sequence:CCGGCTTCGCCTCTACTCTGCCTTTCTCGAGAAAGGCAGAGTAGAGGCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006442.2-311s1c1
Sequence:CCGGGACGGACGAAGAGATTGGGAACTCGAGTTCCCAATCTCTTCGTCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006442.2-664s1c1
Sequence:CCGGAGGAGGATGAATCTGAGGACACTCGAGTGTCCTCAGATTCATCCTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006442.2-779s21c1
Sequence:CCGGCTTCGCCTCTACTCTGCCTTTCTCGAGAAAGGCAGAGTAGAGGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006442.2-377s21c1
Sequence:CCGGCTTCCTAGAGTCGCTGTTGAACTCGAGTTCAACAGCGACTCTAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006442.2-825s21c1
Sequence:CCGGGCACCTGATGAAGAGGACGAACTCGAGTTCGTCCTCTTCATCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006442.2-664s21c1
Sequence:CCGGAGGAGGATGAATCTGAGGACACTCGAGTGTCCTCAGATTCATCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006442
VALIDATED
DRAP1 MISSION shRNA Lentiviral Transduction Particles
DR1-associated protein 1 (negative cofactor 2 alpha)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006442.2-825s1c1
Sequence:CCGGGCACCTGATGAAGAGGACGAACTCGAGTTCGTCCTCTTCATCAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006442.2-377s1c1
Sequence:CCGGCTTCCTAGAGTCGCTGTTGAACTCGAGTTCAACAGCGACTCTAGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006442.2-779s1c1
Sequence:CCGGCTTCGCCTCTACTCTGCCTTTCTCGAGAAAGGCAGAGTAGAGGCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006442.2-311s1c1
Sequence:CCGGGACGGACGAAGAGATTGGGAACTCGAGTTCCCAATCTCTTCGTCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006442.2-664s1c1
Sequence:CCGGAGGAGGATGAATCTGAGGACACTCGAGTGTCCTCAGATTCATCCTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006442.2-779s21c1
Sequence:CCGGCTTCGCCTCTACTCTGCCTTTCTCGAGAAAGGCAGAGTAGAGGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006442.2-377s21c1
Sequence:CCGGCTTCCTAGAGTCGCTGTTGAACTCGAGTTCAACAGCGACTCTAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006442.2-825s21c1
Sequence:CCGGGCACCTGATGAAGAGGACGAACTCGAGTTCGTCCTCTTCATCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006442.2-664s21c1
Sequence:CCGGAGGAGGATGAATCTGAGGACACTCGAGTGTCCTCAGATTCATCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks