EMAIL THIS PAGE TO A FRIEND

DRAXIN

dorsal inhibitory axon guidance protein

55 Gene Product Result for
Synonyms: AGPA3119 C1orf187 UNQ3119 neucrin
UniProtKB ID: Q8NBI3, B6EV15, Q5SNX0, Q6UWK8
Gene ID:
Mouse(70433) dorsal inhibitory axon guidance protein
Rat(691317) dorsal inhibitory axon guidance protein
naked mole-rat(101720964) dorsal inhibitory axon guidance protein
domestic guinea pig(100716459) dorsal inhibitory axon guidance protein
sheep(101111822) dorsal inhibitory axon guidance protein
Zebrafish(619245) dorsal inhibitory axon guidance protein
domestic cat(101099890) dorsal inhibitory axon guidance protein
dog(487442) dorsal inhibitory axon guidance protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198545 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198545 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198545 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027426 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027426 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027426 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198545 Rosetta Predictions human pricing
XM_001077678 Rosetta Predictions rat pricing
NM_027426 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198545 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048830 predicted 1077
2 SASI_Hs01_00048831 predicted 1291
3 SASI_Hs01_00048832 predicted 898
4 SASI_Hs02_00372149 predicted 1033
5 SASI_Hs01_00048833 predicted 832
6 SASI_Hs01_00048834 predicted 1237
7 SASI_Hs01_00048836 predicted 910
8 SASI_Hs01_00048837 predicted 835
9 SASI_Hs01_00048838 predicted 744
10 SASI_Hs01_00048839 predicted 242
11 SASI_Hs01_00048835 predicted 1168
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077678 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00358040 predicted 656
2 SASI_Rn02_00358041 predicted 706
3 SASI_Rn02_00358042 predicted 692
4 SASI_Rn02_00358043 predicted 677
5 SASI_Rn02_00358044 predicted 370
6 SASI_Rn02_00358045 predicted 356
7 SASI_Rn02_00358046 predicted 667
8 SASI_Rn02_00358047 predicted 680
9 SASI_Rn02_00358048 predicted 643
10 SASI_Rn02_00358049 predicted 662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027426 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127217 predicted 791
2 SASI_Mm01_00127218 predicted 1294
3 SASI_Mm01_00127219 predicted 951
4 SASI_Mm01_00127220 predicted 1053
5 SASI_Mm01_00127222 predicted 806
6 SASI_Mm01_00127223 predicted 969
7 SASI_Mm01_00127224 predicted 1279
8 SASI_Mm01_00127225 predicted 826
9 SASI_Mm01_00127226 predicted 1646
10 SASI_Mm02_00332172 predicted 818
11 SASI_Mm01_00127221 predicted 852
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198545
DRAXIN MISSION shRNA Bacterial Glycerol Stock
dorsal inhibitory axon guidance protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198545.3-1079s21c1
Sequence:CCGGGCTGCGCTGCTATGCCAAATTCTCGAGAATTTGGCATAGCAGCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198545.3-919s21c1
Sequence:CCGGCCAGTGATGGTAACGAAACATCTCGAGATGTTTCGTTACCATCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198545.3-1253s21c1
Sequence:CCGGACTAGCAGTGGGAGATCAAGTCTCGAGACTTGATCTCCCACTGCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198545.3-1577s21c1
Sequence:CCGGTATGGAACATCTCCTATGTACCTCGAGGTACATAGGAGATGTTCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198545.2-3044s1c1
Sequence:CCGGGCAGAATCTTAGCCTAGGCAACTCGAGTTGCCTAGGCTAAGATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198545.2-1041s1c1
Sequence:CCGGCAAATGCTTCGATGACTGCATCTCGAGATGCAGTCATCGAAGCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198545.2-1032s1c1
Sequence:CCGGCCTCAACAACAAATGCTTCGACTCGAGTCGAAGCATTTGTTGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134037    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198545.2-1872s1c1
Sequence:CCGGCCTAATAAACCTCCAGTGTTACTCGAGTAACACTGGAGGTTTATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198545.2-246s1c1
Sequence:CCGGCCCTGAGAATCACATTGACCTCTCGAGAGGTCAATGTGATTCTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198545
DRAXIN MISSION shRNA shRNA Plasmid DNA
dorsal inhibitory axon guidance protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198545.3-1079s21c1
Sequence:CCGGGCTGCGCTGCTATGCCAAATTCTCGAGAATTTGGCATAGCAGCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198545.3-919s21c1
Sequence:CCGGCCAGTGATGGTAACGAAACATCTCGAGATGTTTCGTTACCATCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198545.3-1253s21c1
Sequence:CCGGACTAGCAGTGGGAGATCAAGTCTCGAGACTTGATCTCCCACTGCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198545.3-1577s21c1
Sequence:CCGGTATGGAACATCTCCTATGTACCTCGAGGTACATAGGAGATGTTCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198545.2-3044s1c1
Sequence:CCGGGCAGAATCTTAGCCTAGGCAACTCGAGTTGCCTAGGCTAAGATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198545.2-1041s1c1
Sequence:CCGGCAAATGCTTCGATGACTGCATCTCGAGATGCAGTCATCGAAGCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198545.2-1032s1c1
Sequence:CCGGCCTCAACAACAAATGCTTCGACTCGAGTCGAAGCATTTGTTGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134037    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198545.2-1872s1c1
Sequence:CCGGCCTAATAAACCTCCAGTGTTACTCGAGTAACACTGGAGGTTTATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198545.2-246s1c1
Sequence:CCGGCCCTGAGAATCACATTGACCTCTCGAGAGGTCAATGTGATTCTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198545
DRAXIN MISSION shRNA Lentiviral Transduction Particles
dorsal inhibitory axon guidance protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198545.3-1079s21c1
Sequence:CCGGGCTGCGCTGCTATGCCAAATTCTCGAGAATTTGGCATAGCAGCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198545.3-919s21c1
Sequence:CCGGCCAGTGATGGTAACGAAACATCTCGAGATGTTTCGTTACCATCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198545.3-1253s21c1
Sequence:CCGGACTAGCAGTGGGAGATCAAGTCTCGAGACTTGATCTCCCACTGCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198545.3-1577s21c1
Sequence:CCGGTATGGAACATCTCCTATGTACCTCGAGGTACATAGGAGATGTTCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198545.2-3044s1c1
Sequence:CCGGGCAGAATCTTAGCCTAGGCAACTCGAGTTGCCTAGGCTAAGATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198545.2-1041s1c1
Sequence:CCGGCAAATGCTTCGATGACTGCATCTCGAGATGCAGTCATCGAAGCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198545.2-1032s1c1
Sequence:CCGGCCTCAACAACAAATGCTTCGACTCGAGTCGAAGCATTTGTTGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134037    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198545.2-1872s1c1
Sequence:CCGGCCTAATAAACCTCCAGTGTTACTCGAGTAACACTGGAGGTTTATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198545.2-246s1c1
Sequence:CCGGCCCTGAGAATCACATTGACCTCTCGAGAGGTCAATGTGATTCTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027426
DRAXIN MISSION shRNA Bacterial Glycerol Stock
dorsal inhibitory axon guidance protein
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027426.1-796s1c1
Sequence:CCGGCACACTGGACATGGCCTTATTCTCGAGAATAAGGCCATGTCCAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027426.1-1451s1c1
Sequence:CCGGCCAGCATTGCAGCAGTTTCAACTCGAGTTGAAACTGCTGCAATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027426.1-823s1c1
Sequence:CCGGGACGGATTATGAAGACTTAAACTCGAGTTTAAGTCTTCATAATCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027426.1-809s1c1
Sequence:CCGGGCCTTATTTGACTGGACGGATCTCGAGATCCGTCCAGTCAAATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027426.1-2620s1c1
Sequence:CCGGGCTGTTTACTGCTTTGGGATACTCGAGTATCCCAAAGCAGTAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027426.1-1024s1c1
Sequence:CCGGCAAATGTTTCGACGACTGCATCTCGAGATGCAGTCGTCGAAACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027426
DRAXIN MISSION shRNA shRNA Plasmid DNA
dorsal inhibitory axon guidance protein
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027426.1-796s1c1
Sequence:CCGGCACACTGGACATGGCCTTATTCTCGAGAATAAGGCCATGTCCAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027426.1-1451s1c1
Sequence:CCGGCCAGCATTGCAGCAGTTTCAACTCGAGTTGAAACTGCTGCAATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027426.1-823s1c1
Sequence:CCGGGACGGATTATGAAGACTTAAACTCGAGTTTAAGTCTTCATAATCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027426.1-809s1c1
Sequence:CCGGGCCTTATTTGACTGGACGGATCTCGAGATCCGTCCAGTCAAATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027426.1-2620s1c1
Sequence:CCGGGCTGTTTACTGCTTTGGGATACTCGAGTATCCCAAAGCAGTAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027426.1-1024s1c1
Sequence:CCGGCAAATGTTTCGACGACTGCATCTCGAGATGCAGTCGTCGAAACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027426
DRAXIN MISSION shRNA Lentiviral Transduction Particles
dorsal inhibitory axon guidance protein
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027426.1-796s1c1
Sequence:CCGGCACACTGGACATGGCCTTATTCTCGAGAATAAGGCCATGTCCAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027426.1-1451s1c1
Sequence:CCGGCCAGCATTGCAGCAGTTTCAACTCGAGTTGAAACTGCTGCAATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027426.1-823s1c1
Sequence:CCGGGACGGATTATGAAGACTTAAACTCGAGTTTAAGTCTTCATAATCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027426.1-809s1c1
Sequence:CCGGGCCTTATTTGACTGGACGGATCTCGAGATCCGTCCAGTCAAATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027426.1-2620s1c1
Sequence:CCGGGCTGTTTACTGCTTTGGGATACTCGAGTATCCCAAAGCAGTAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027426.1-1024s1c1
Sequence:CCGGCAAATGTTTCGACGACTGCATCTCGAGATGCAGTCGTCGAAACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks