EMAIL THIS PAGE TO A FRIEND

DRC1

dynein regulatory complex subunit 1 homolog (Chlamydomonas)

47 Gene Product Result for
Synonyms: C2orf39 CCDC164 CILD21
UniProtKB ID: Q96MC2, A8K1N8, Q53R91, Q53TA3, Q8NDI5
Gene ID:
Mouse(381738) dynein regulatory complex subunit 1
Rat(362712) dynein regulatory complex subunit 1 homolog (Chlamydomonas)
Zebrafish(100034551) dynein regulatory complex subunit 1 homolog (Chlamydomonas)
cow(509524) coiled-coil domain containing 164
naked mole-rat(101697182) dynein regulatory complex subunit 1 homolog (Chlamydomonas)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301681 ANTI-C2ORF39 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145038 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145038 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145038 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033460 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033460 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033460 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU063981 MISSION® esiRNA esiRNA human C2orf39 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145038 Rosetta Predictions human pricing
NM_001007009 Rosetta Predictions rat pricing
NM_001033460 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145038 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030040 predicted 1195
2 SASI_Hs01_00030042 predicted 307
3 SASI_Hs02_00364911 predicted 1375
4 SASI_Hs01_00030043 predicted 1297
5 SASI_Hs02_00364912 predicted 750
6 SASI_Hs01_00030044 predicted 1085
7 SASI_Hs02_00364913 predicted 409
8 SASI_Hs01_00030045 predicted 991
9 SASI_Hs01_00030047 predicted 722
10 SASI_Hs01_00030048 predicted 635
11 SASI_Hs01_00030039 predicted 749
12 SASI_Hs01_00030041 predicted 537
13 SASI_Hs01_00030046 predicted 1110
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007009 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092277 predicted 472
2 SASI_Rn01_00092279 predicted 1197
3 SASI_Rn02_00198597 predicted 1196
4 SASI_Rn01_00092280 predicted 700
5 SASI_Rn01_00092281 predicted 735
6 SASI_Rn01_00092282 predicted 744
7 SASI_Rn01_00092284 predicted 1240
8 SASI_Rn01_00092285 predicted 2028
9 SASI_Rn01_00092286 predicted 1700
10 SASI_Rn02_00198598 predicted 1888
11 SASI_Rn01_00092278 predicted 1400
12 SASI_Rn01_00092283 predicted 1826
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033460 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154864 predicted 1508
2 SASI_Mm01_00154865 predicted 744
3 SASI_Mm01_00154866 predicted 2093
4 SASI_Mm01_00154867 predicted 1682
5 SASI_Mm02_00288798 predicted 2054
6 SASI_Mm01_00154869 predicted 1031
7 SASI_Mm01_00154870 predicted 986
8 SASI_Mm01_00154871 predicted 991
9 SASI_Mm01_00154873 predicted 1535
10 SASI_Mm02_00288799 predicted 1758
11 SASI_Mm01_00154868 predicted 772
12 SASI_Mm01_00154872 predicted 1111
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145038
DRC1 MISSION shRNA Bacterial Glycerol Stock
dynein regulatory complex subunit 1 homolog (Chlamydomonas)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145038.1-1391s1c1
Sequence:CCGGCCTGAACAATGTTGGGCCTATCTCGAGATAGGCCCAACATTGTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145038.1-635s1c1
Sequence:CCGGCCAGTATGTGAAGGATTTGAACTCGAGTTCAAATCCTTCACATACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145038.1-1631s1c1
Sequence:CCGGGCAGAATGAATGCTATCTGCTCTCGAGAGCAGATAGCATTCATTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145038.1-1392s1c1
Sequence:CCGGCTGAACAATGTTGGGCCTATTCTCGAGAATAGGCCCAACATTGTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145038.1-993s1c1
Sequence:CCGGGCAATTTATCAGCTAAACCAACTCGAGTTGGTTTAGCTGATAAATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145038.2-905s21c1
Sequence:CCGGGATCTGGGATTGCGAAGAATACTCGAGTATTCTTCGCAATCCCAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145038.2-1193s21c1
Sequence:CCGGCAAACGTCTTGTGATGCAATTCTCGAGAATTGCATCACAAGACGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145038.2-344s21c1
Sequence:CCGGCACCGAGTTGGTGACAAATATCTCGAGATATTTGTCACCAACTCGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145038.2-309s21c1
Sequence:CCGGAGCCGATTGAAATTGGCTAAACTCGAGTTTAGCCAATTTCAATCGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145038
DRC1 MISSION shRNA shRNA Plasmid DNA
dynein regulatory complex subunit 1 homolog (Chlamydomonas)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145038.1-1391s1c1
Sequence:CCGGCCTGAACAATGTTGGGCCTATCTCGAGATAGGCCCAACATTGTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145038.1-635s1c1
Sequence:CCGGCCAGTATGTGAAGGATTTGAACTCGAGTTCAAATCCTTCACATACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145038.1-1631s1c1
Sequence:CCGGGCAGAATGAATGCTATCTGCTCTCGAGAGCAGATAGCATTCATTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145038.1-1392s1c1
Sequence:CCGGCTGAACAATGTTGGGCCTATTCTCGAGAATAGGCCCAACATTGTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145038.1-993s1c1
Sequence:CCGGGCAATTTATCAGCTAAACCAACTCGAGTTGGTTTAGCTGATAAATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145038.2-905s21c1
Sequence:CCGGGATCTGGGATTGCGAAGAATACTCGAGTATTCTTCGCAATCCCAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145038.2-1193s21c1
Sequence:CCGGCAAACGTCTTGTGATGCAATTCTCGAGAATTGCATCACAAGACGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145038.2-344s21c1
Sequence:CCGGCACCGAGTTGGTGACAAATATCTCGAGATATTTGTCACCAACTCGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145038.2-309s21c1
Sequence:CCGGAGCCGATTGAAATTGGCTAAACTCGAGTTTAGCCAATTTCAATCGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145038
DRC1 MISSION shRNA Lentiviral Transduction Particles
dynein regulatory complex subunit 1 homolog (Chlamydomonas)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145038.1-1391s1c1
Sequence:CCGGCCTGAACAATGTTGGGCCTATCTCGAGATAGGCCCAACATTGTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145038.1-635s1c1
Sequence:CCGGCCAGTATGTGAAGGATTTGAACTCGAGTTCAAATCCTTCACATACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145038.1-1631s1c1
Sequence:CCGGGCAGAATGAATGCTATCTGCTCTCGAGAGCAGATAGCATTCATTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145038.1-1392s1c1
Sequence:CCGGCTGAACAATGTTGGGCCTATTCTCGAGAATAGGCCCAACATTGTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145038.1-993s1c1
Sequence:CCGGGCAATTTATCAGCTAAACCAACTCGAGTTGGTTTAGCTGATAAATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145038.2-905s21c1
Sequence:CCGGGATCTGGGATTGCGAAGAATACTCGAGTATTCTTCGCAATCCCAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145038.2-1193s21c1
Sequence:CCGGCAAACGTCTTGTGATGCAATTCTCGAGAATTGCATCACAAGACGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145038.2-344s21c1
Sequence:CCGGCACCGAGTTGGTGACAAATATCTCGAGATATTTGTCACCAACTCGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145038.2-309s21c1
Sequence:CCGGAGCCGATTGAAATTGGCTAAACTCGAGTTTAGCCAATTTCAATCGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033460
DRC1 MISSION shRNA Bacterial Glycerol Stock
dynein regulatory complex subunit 1 homolog (Chlamydomonas)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033460.3-1248s21c1
Sequence:CCGGAGGAGAAGTTTCGGGAGATTTCTCGAGAAATCTCCCGAAACTTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033460.3-726s21c1
Sequence:CCGGAGCTGATTCACATCGAGAAAGCTCGAGCTTTCTCGATGTGAATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033460.3-1183s21c1
Sequence:CCGGCAAACGGCTTGTGACGCAATTCTCGAGAATTGCGTCACAAGCCGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033460.3-2090s21c1
Sequence:CCGGGAATCCCTGGCTGCGGTTATTCTCGAGAATAACCGCAGCCAGGGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033460.3-334s21c1
Sequence:CCGGGACCGAGTTGGTGACAAATATCTCGAGATATTTGTCACCAACTCGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033460.3-1484s21c1
Sequence:CCGGATGTCGGAAGACGAGGATTACCTCGAGGTAATCCTCGTCTTCCGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033460.3-136s21c1
Sequence:CCGGACCCTCGGTGCATTCGGATAACTCGAGTTATCCGAATGCACCGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033460
DRC1 MISSION shRNA shRNA Plasmid DNA
dynein regulatory complex subunit 1 homolog (Chlamydomonas)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033460.3-1248s21c1
Sequence:CCGGAGGAGAAGTTTCGGGAGATTTCTCGAGAAATCTCCCGAAACTTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033460.3-726s21c1
Sequence:CCGGAGCTGATTCACATCGAGAAAGCTCGAGCTTTCTCGATGTGAATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033460.3-1183s21c1
Sequence:CCGGCAAACGGCTTGTGACGCAATTCTCGAGAATTGCGTCACAAGCCGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033460.3-2090s21c1
Sequence:CCGGGAATCCCTGGCTGCGGTTATTCTCGAGAATAACCGCAGCCAGGGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033460.3-334s21c1
Sequence:CCGGGACCGAGTTGGTGACAAATATCTCGAGATATTTGTCACCAACTCGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033460.3-1484s21c1
Sequence:CCGGATGTCGGAAGACGAGGATTACCTCGAGGTAATCCTCGTCTTCCGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033460.3-136s21c1
Sequence:CCGGACCCTCGGTGCATTCGGATAACTCGAGTTATCCGAATGCACCGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033460
DRC1 MISSION shRNA Lentiviral Transduction Particles
dynein regulatory complex subunit 1 homolog (Chlamydomonas)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033460.3-1248s21c1
Sequence:CCGGAGGAGAAGTTTCGGGAGATTTCTCGAGAAATCTCCCGAAACTTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033460.3-726s21c1
Sequence:CCGGAGCTGATTCACATCGAGAAAGCTCGAGCTTTCTCGATGTGAATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033460.3-1183s21c1
Sequence:CCGGCAAACGGCTTGTGACGCAATTCTCGAGAATTGCGTCACAAGCCGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033460.3-2090s21c1
Sequence:CCGGGAATCCCTGGCTGCGGTTATTCTCGAGAATAACCGCAGCCAGGGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033460.3-334s21c1
Sequence:CCGGGACCGAGTTGGTGACAAATATCTCGAGATATTTGTCACCAACTCGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033460.3-1484s21c1
Sequence:CCGGATGTCGGAAGACGAGGATTACCTCGAGGTAATCCTCGTCTTCCGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033460.3-136s21c1
Sequence:CCGGACCCTCGGTGCATTCGGATAACTCGAGTTATCCGAATGCACCGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)