EMAIL THIS PAGE TO A FRIEND

DRD1

dopamine receptor D1

145 Gene Product Result for
Synonyms: DADR DRD1A
UniProtKB ID: P21728, B2RA44, Q4QRJ0
Gene ID:
Human(1812) Summary: This gene encodes the D1 subtype of the dopamine receptor. The D1 subtype is the most abundant dopamine receptor in the central nervous system. This G-protein coupled receptor stimulates adenylyl cyclase and activates cyclic AMP-dependent protein kinases. D1 receptors regulate neuronal growth and development, mediate some behavioral responses, and modulate dopamine receptor D2-mediated events. Alternate transcription initiation sites result in two transcript variants of this gene. [provided by RefSeq, Jul 2008]
Rat(24316) dopamine receptor D1
Thale Cress(816136) putative chromatin remodeling protein
chicken(427633) dopamine receptor D1
dog(489110) dopamine receptor D1
domestic cat(101085098) dopamine receptor D1
cow(281125) dopamine receptor D1
Horse(100058846) dopamine receptor D1
naked mole-rat(101720342) dopamine receptor D1
domestic guinea pig(100729180) dopamine receptor D1
sheep(100568292) dopamine receptor D1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Precursor

Product # Description Species Add to Cart
 
D9503 3,4-Dihydroxy-DL-phenylalanine human, mouse, rat pricing
D9628 3,4-Dihydroxy-L-phenylalanine ≥98% (TLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000794 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000794 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000794 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU000091 MISSION® esiRNA esiRNA targeting human DRD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000794 Rosetta Predictions human pricing
NM_012546 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000794 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051937 predicted 1985
2 SASI_Hs01_00051938 predicted 1695
3 SASI_Hs01_00051939 predicted 2217
4 SASI_Hs02_00303240 predicted 1525
5 SASI_Hs01_00051941 predicted 1582
6 SASI_Hs01_00051942 predicted 2010
7 SASI_Hs01_00051943 predicted 1745
8 SASI_Hs01_00051944 predicted 1283
9 SASI_Hs01_00051946 predicted 2245
10 SASI_Hs02_00303241 predicted 2196
11 SASI_Hs01_00051940 predicted 1803
12 SASI_Hs01_00051945 predicted 1789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012546 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065794 predicted 1332
2 SASI_Rn01_00065795 predicted 241
3 SASI_Rn01_00065797 predicted 469
4 SASI_Rn01_00065798 predicted 831
5 SASI_Rn01_00065799 predicted 1127
6 SASI_Rn01_00065800 predicted 825
7 SASI_Rn01_00065801 predicted 681
8 SASI_Rn01_00065802 predicted 617
9 SASI_Rn02_00259628 predicted 702
10 SASI_Rn01_00065803 predicted 844
11 SASI_Rn01_00065796 predicted 803
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000794
DRD1 MISSION shRNA Bacterial Glycerol Stock
dopamine receptor D1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000794.3-2708s21c1
Sequence:CCGGTAGGTGCATGCCTTCATAAATCTCGAGATTTATGAAGGCATGCACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000794.3-1935s21c1
Sequence:CCGGTTATGCCTTTAATGCTGATTTCTCGAGAAATCAGCATTAAAGGCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218388    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000794.3-2458s21c1
Sequence:GTACCGGCTGTGTTGTTCATAGTCAATCCTCGAGGATTGACTATGAACAACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000794.3-2204s21c1
Sequence:CCGGTATCAGTCATATTGGACTATGCTCGAGCATAGTCCAATATGACTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000794.3-2018s21c1
Sequence:CCGGTAGAGACGGTGAGTATCAATACTCGAGTATTGATACTCACCGTCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000794.3-1993s21c1
Sequence:CCGGCTTTGCCCTGCGACGAATAATCTCGAGATTATTCGTCGCAGGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000794.3-1895s21c1
Sequence:CCGGTGTGGTTTGGGTGGGCTAATTCTCGAGAATTAGCCCACCCAAACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000794.2-2169s1c1
Sequence:CCGGGCTGCTTTCCAACACACAATTCTCGAGAATTGTGTGTTGGAAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000794.2-1692s1c1
Sequence:CCGGCCCATCATTTATGCCTTTAATCTCGAGATTAAAGGCATAAATGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000794.2-1967s1c1
Sequence:CCGGCCTATCGGTCATATTGGACTACTCGAGTAGTCCAATATGACCGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000794.2-1293s1c1
Sequence:CCGGGCCATCTCATCCTCTGTAATACTCGAGTATTACAGAGGATGAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000794
DRD1 MISSION shRNA shRNA Plasmid DNA
dopamine receptor D1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000794.3-2708s21c1
Sequence:CCGGTAGGTGCATGCCTTCATAAATCTCGAGATTTATGAAGGCATGCACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000794.3-1935s21c1
Sequence:CCGGTTATGCCTTTAATGCTGATTTCTCGAGAAATCAGCATTAAAGGCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218388    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000794.3-2458s21c1
Sequence:GTACCGGCTGTGTTGTTCATAGTCAATCCTCGAGGATTGACTATGAACAACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000794.3-2204s21c1
Sequence:CCGGTATCAGTCATATTGGACTATGCTCGAGCATAGTCCAATATGACTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000794.3-2018s21c1
Sequence:CCGGTAGAGACGGTGAGTATCAATACTCGAGTATTGATACTCACCGTCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000794.3-1993s21c1
Sequence:CCGGCTTTGCCCTGCGACGAATAATCTCGAGATTATTCGTCGCAGGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000794.3-1895s21c1
Sequence:CCGGTGTGGTTTGGGTGGGCTAATTCTCGAGAATTAGCCCACCCAAACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000794.2-2169s1c1
Sequence:CCGGGCTGCTTTCCAACACACAATTCTCGAGAATTGTGTGTTGGAAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000794.2-1692s1c1
Sequence:CCGGCCCATCATTTATGCCTTTAATCTCGAGATTAAAGGCATAAATGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000794.2-1967s1c1
Sequence:CCGGCCTATCGGTCATATTGGACTACTCGAGTAGTCCAATATGACCGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000794.2-1293s1c1
Sequence:CCGGGCCATCTCATCCTCTGTAATACTCGAGTATTACAGAGGATGAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000794
DRD1 MISSION shRNA Lentiviral Transduction Particles
dopamine receptor D1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000794.3-2708s21c1
Sequence:CCGGTAGGTGCATGCCTTCATAAATCTCGAGATTTATGAAGGCATGCACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000794.3-1935s21c1
Sequence:CCGGTTATGCCTTTAATGCTGATTTCTCGAGAAATCAGCATTAAAGGCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218388    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000794.3-2458s21c1
Sequence:GTACCGGCTGTGTTGTTCATAGTCAATCCTCGAGGATTGACTATGAACAACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000794.3-2204s21c1
Sequence:CCGGTATCAGTCATATTGGACTATGCTCGAGCATAGTCCAATATGACTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000794.3-2018s21c1
Sequence:CCGGTAGAGACGGTGAGTATCAATACTCGAGTATTGATACTCACCGTCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000794.3-1993s21c1
Sequence:CCGGCTTTGCCCTGCGACGAATAATCTCGAGATTATTCGTCGCAGGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000794.3-1895s21c1
Sequence:CCGGTGTGGTTTGGGTGGGCTAATTCTCGAGAATTAGCCCACCCAAACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000794.2-2169s1c1
Sequence:CCGGGCTGCTTTCCAACACACAATTCTCGAGAATTGTGTGTTGGAAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000794.2-1692s1c1
Sequence:CCGGCCCATCATTTATGCCTTTAATCTCGAGATTAAAGGCATAAATGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000794.2-1967s1c1
Sequence:CCGGCCTATCGGTCATATTGGACTACTCGAGTAGTCCAATATGACCGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000794.2-1293s1c1
Sequence:CCGGGCCATCTCATCCTCTGTAATACTCGAGTATTACAGAGGATGAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks