EMAIL THIS PAGE TO A FRIEND

DRD3

dopamine receptor D3

111 Gene Product Result for
Synonyms: D3DR ETM1 FET1
UniProtKB ID: P35462, A1A4V5, Q4VBM8
Gene ID:
Human(1814) Summary: This gene encodes the D3 subtype of the five (D1-D5) dopamine receptors. The activity of the D3 subtype receptor is mediated by G proteins which inhibit adenylyl cyclase. This receptor is localized to the limbic areas of the brain, which are associated with cognitive, emotional, and endocrine functions. Genetic variation in this gene may be associated with susceptibility to hereditary essential tremor 1. Alternative splicing of this gene results in transcript variants encoding different isoforms, although some variants may be subject to nonsense-mediated decay (NMD). [provided by RefSeq, Jul 2008]
Mouse(13490) dopamine receptor D3
Rat(29238) dopamine receptor D3
Zebrafish(282554) dopamine receptor D3
cow(537043) dopamine receptor D3
Horse(100061160) dopamine receptor D3
domestic cat(101092878) dopamine receptor D3
dog(487984) dopamine receptor D3
chicken(770757) dopamine receptor D3
naked mole-rat(101713857) dopamine receptor D3
domestic guinea pig(100716075) dopamine receptor D3
sheep(101103110) dopamine receptor D3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2900444 Anti-DRD3 / DOPAMINE antibody produced in rabbit affinity isolated antibody hamster, horse, mouse, human, monkey, dog, pig
immunohistochemistry pricing
SAB2900013 Anti-DRD3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB2107765 Anti-DRD3 antibody produced in rabbit affinity isolated antibody human, horse, guinea pig
ELISA, western blot pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
C8912 Cocaine free base human, mouse, rat pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
C6305 Clozapine human, rat pricing
H1512 Haloperidol powder human, rat pricing

Small Molecule - Precursor

Product # Description Species Add to Cart
 
D9503 3,4-Dihydroxy-DL-phenylalanine human, mouse, rat pricing
D9628 3,4-Dihydroxy-L-phenylalanine ≥98% (TLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007877 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007877 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007877 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000796 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000796 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000796 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU123071 MISSION® esiRNA esiRNA human DRD3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000796 Rosetta Predictions human pricing
NM_033663 Rosetta Predictions human pricing
NM_017140 Rosetta Predictions rat pricing
NM_007877 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000796 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113267 predicted 665
2 SASI_Hs01_00113268 predicted 428
3 SASI_Hs01_00113269 predicted 823
4 SASI_Hs01_00113270 predicted 926
5 SASI_Hs01_00113271 predicted 610
6 SASI_Hs01_00113272 predicted 521
7 SASI_Hs02_00303243 predicted 1039
8 SASI_Hs01_00113273 predicted 804
9 SASI_Hs01_00113275 predicted 931
10 SASI_Hs01_00113276 predicted 558
11 SASI_Hs01_00113274 predicted 689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033663 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086510 predicted 666
2 SASI_Hs01_00086511 predicted 432
3 SASI_Hs01_00086512 predicted 815
4 SASI_Hs01_00086513 predicted 926
5 SASI_Hs01_00086514 predicted 606
6 SASI_Hs01_00086515 predicted 528
7 SASI_Hs02_00361473 predicted 1037
8 SASI_Hs01_00086516 predicted 804
9 SASI_Hs01_00086518 predicted 924
10 SASI_Hs01_00086519 predicted 567
11 SASI_Hs01_00086517 predicted 692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017140 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033274 predicted 540
2 SASI_Rn01_00033275 predicted 524
3 SASI_Rn01_00033276 predicted 978
4 SASI_Rn01_00033277 predicted 1174
5 SASI_Rn01_00033278 predicted 1253
6 SASI_Rn01_00033280 predicted 1245
7 SASI_Rn01_00033281 predicted 520
8 SASI_Rn02_00261390 predicted 575
9 SASI_Rn02_00261391 predicted 713
10 SASI_Rn01_00033283 predicted 1117
11 SASI_Rn01_00033279 predicted 339
12 SASI_Rn01_00033282 predicted 866
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007877 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104662 predicted 1115
2 SASI_Mm01_00104663 predicted 802
3 SASI_Mm01_00104664 predicted 899
4 SASI_Mm01_00104665 predicted 1085
5 SASI_Mm01_00104666 predicted 389
6 SASI_Mm02_00312664 predicted 656
7 SASI_Mm01_00104667 predicted 445
8 SASI_Mm01_00104668 predicted 1040
9 SASI_Mm01_00104669 predicted 1002
10 SASI_Mm01_00104670 predicted 390
11 SASI_Mm01_00104671 predicted 442
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007877
DRD3 MISSION shRNA Bacterial Glycerol Stock
dopamine receptor D3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007877.1-1168s1c1
Sequence:CCGGCCCTTCTTCTTGACTCACGTTCTCGAGAACGTGAGTCAAGAAGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007877.1-790s1c1
Sequence:CCGGACGGGACAAATGGAGCACATACTCGAGTATGTGCTCCATTTGTCCCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007877.1-1017s1c1
Sequence:CCGGGCTCAGCTTAGAGGTTCGAAACTCGAGTTTCGAACCTCTAAGCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007877.1-498s1c1
Sequence:CCGGCCCTCTCCTCTTTGGTTTCAACTCGAGTTGAAACCAAAGAGGAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007877.1-841s1c1
Sequence:CCGGGACCCTCTCTTGTCACATCTACTCGAGTAGATGTGACAAGAGAGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007877.1-274s21c1
Sequence:CCGGACAGGTGGAGTCTGGAATTTCCTCGAGGAAATTCCAGACTCCACCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007877.1-676s21c1
Sequence:CCGGAGACAGAACAGCCAGTGTATCCTCGAGGATACACTGGCTGTTCTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007877
DRD3 MISSION shRNA shRNA Plasmid DNA
dopamine receptor D3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007877.1-1168s1c1
Sequence:CCGGCCCTTCTTCTTGACTCACGTTCTCGAGAACGTGAGTCAAGAAGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007877.1-790s1c1
Sequence:CCGGACGGGACAAATGGAGCACATACTCGAGTATGTGCTCCATTTGTCCCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007877.1-1017s1c1
Sequence:CCGGGCTCAGCTTAGAGGTTCGAAACTCGAGTTTCGAACCTCTAAGCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007877.1-498s1c1
Sequence:CCGGCCCTCTCCTCTTTGGTTTCAACTCGAGTTGAAACCAAAGAGGAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007877.1-841s1c1
Sequence:CCGGGACCCTCTCTTGTCACATCTACTCGAGTAGATGTGACAAGAGAGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007877.1-274s21c1
Sequence:CCGGACAGGTGGAGTCTGGAATTTCCTCGAGGAAATTCCAGACTCCACCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007877.1-676s21c1
Sequence:CCGGAGACAGAACAGCCAGTGTATCCTCGAGGATACACTGGCTGTTCTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007877
DRD3 MISSION shRNA Lentiviral Transduction Particles
dopamine receptor D3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007877.1-1168s1c1
Sequence:CCGGCCCTTCTTCTTGACTCACGTTCTCGAGAACGTGAGTCAAGAAGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007877.1-790s1c1
Sequence:CCGGACGGGACAAATGGAGCACATACTCGAGTATGTGCTCCATTTGTCCCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007877.1-1017s1c1
Sequence:CCGGGCTCAGCTTAGAGGTTCGAAACTCGAGTTTCGAACCTCTAAGCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007877.1-498s1c1
Sequence:CCGGCCCTCTCCTCTTTGGTTTCAACTCGAGTTGAAACCAAAGAGGAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007877.1-841s1c1
Sequence:CCGGGACCCTCTCTTGTCACATCTACTCGAGTAGATGTGACAAGAGAGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007877.1-274s21c1
Sequence:CCGGACAGGTGGAGTCTGGAATTTCCTCGAGGAAATTCCAGACTCCACCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007877.1-676s21c1
Sequence:CCGGAGACAGAACAGCCAGTGTATCCTCGAGGATACACTGGCTGTTCTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000796
DRD3 MISSION shRNA Bacterial Glycerol Stock
dopamine receptor D3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000796.2-1192s1c1
Sequence:CCGGGCAATGGCAGATTATCGACATCTCGAGATGTCGATAATCTGCCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000796.2-786s1c1
Sequence:CCGGCCTCTTCTGTTTGGCTTTAATCTCGAGATTAAAGCCAAACAGAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000796.2-902s1c1
Sequence:CCGGCCTTGTCTATGCCAGAATCTACTCGAGTAGATTCTGGCATAGACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000796.2-570s1c1
Sequence:CCGGGTCTGGAATTTCAGCCGCATTCTCGAGAATGCGGCTGAAATTCCAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000796.2-1317s1c1
Sequence:CCGGCCCTTCTTCTTGACCCATGTTCTCGAGAACATGGGTCAAGAAGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000796.3-613s21c1
Sequence:CCGGAGACTACCACCAACTACTTAGCTCGAGCTAAGTAGTTGGTGGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000796.3-771s21c1
Sequence:CCGGTGTACAGCCAGCATCCTTAATCTCGAGATTAAGGATGCTGGCTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000796.3-1036s21c1
Sequence:CCGGGAGTGACTGTCCTTGTCTATGCTCGAGCATAGACAAGGACAGTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000796
DRD3 MISSION shRNA shRNA Plasmid DNA
dopamine receptor D3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000796.2-1192s1c1
Sequence:CCGGGCAATGGCAGATTATCGACATCTCGAGATGTCGATAATCTGCCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000796.2-786s1c1
Sequence:CCGGCCTCTTCTGTTTGGCTTTAATCTCGAGATTAAAGCCAAACAGAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000796.2-902s1c1
Sequence:CCGGCCTTGTCTATGCCAGAATCTACTCGAGTAGATTCTGGCATAGACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000796.2-570s1c1
Sequence:CCGGGTCTGGAATTTCAGCCGCATTCTCGAGAATGCGGCTGAAATTCCAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000796.2-1317s1c1
Sequence:CCGGCCCTTCTTCTTGACCCATGTTCTCGAGAACATGGGTCAAGAAGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000796.3-613s21c1
Sequence:CCGGAGACTACCACCAACTACTTAGCTCGAGCTAAGTAGTTGGTGGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000796.3-771s21c1
Sequence:CCGGTGTACAGCCAGCATCCTTAATCTCGAGATTAAGGATGCTGGCTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000796.3-1036s21c1
Sequence:CCGGGAGTGACTGTCCTTGTCTATGCTCGAGCATAGACAAGGACAGTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000796
DRD3 MISSION shRNA Lentiviral Transduction Particles
dopamine receptor D3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000796.2-1192s1c1
Sequence:CCGGGCAATGGCAGATTATCGACATCTCGAGATGTCGATAATCTGCCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000796.2-786s1c1
Sequence:CCGGCCTCTTCTGTTTGGCTTTAATCTCGAGATTAAAGCCAAACAGAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000796.2-902s1c1
Sequence:CCGGCCTTGTCTATGCCAGAATCTACTCGAGTAGATTCTGGCATAGACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000796.2-570s1c1
Sequence:CCGGGTCTGGAATTTCAGCCGCATTCTCGAGAATGCGGCTGAAATTCCAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000796.2-1317s1c1
Sequence:CCGGCCCTTCTTCTTGACCCATGTTCTCGAGAACATGGGTCAAGAAGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000796.3-613s21c1
Sequence:CCGGAGACTACCACCAACTACTTAGCTCGAGCTAAGTAGTTGGTGGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000796.3-771s21c1
Sequence:CCGGTGTACAGCCAGCATCCTTAATCTCGAGATTAAGGATGCTGGCTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000796.3-1036s21c1
Sequence:CCGGGAGTGACTGTCCTTGTCTATGCTCGAGCATAGACAAGGACAGTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks