EMAIL THIS PAGE TO A FRIEND

DRD4

dopamine receptor D4

84 Gene Product Result for
Synonyms: D4DR
UniProtKB ID: P21917, B0M0J7, Q7Z7Q5, Q8NGM5
Gene ID:
Human(1815) Summary: This gene encodes the D4 subtype of the dopamine receptor. The D4 subtype is a G-protein coupled receptor which inhibits adenylyl cyclase. It is a target for drugs which treat schizophrenia and Parkinson disease. Mutations in this gene have been associated with various behavioral phenotypes, including autonomic nervous system dysfunction, attention deficit/hyperactivity disorder, and the personality trait of novelty seeking. This gene contains a polymorphic number (2-10 copies) of tandem 48 nt repeats; the sequence shown contains four repeats. [provided by RefSeq, Jul 2008]
Mouse(13491) dopamine receptor D4
Rat(25432) dopamine receptor D4
domestic guinea pig(100733356) dopamine receptor D4
naked mole-rat(101708437) dopamine receptor D4
chicken(423016) dopamine receptor D4
dog(607223) dopamine receptor D4
dog(448805) dopamine receptor D4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
F4429 FAUC 213 ≥98% (HPLC), solid human pricing
B9308 BP897 >98% (HPLC), solid human, rat pricing

Small Molecule - Precursor

Product # Description Species Add to Cart
 
D9503 3,4-Dihydroxy-DL-phenylalanine human, mouse, rat pricing
D9628 3,4-Dihydroxy-L-phenylalanine ≥98% (TLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007878 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007878 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007878 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000797 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000797 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000797 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU028911 MISSION® esiRNA esiRNA targeting mouse Drd4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000797 Rosetta Predictions human pricing
NM_012944 Rosetta Predictions rat pricing
NM_007878 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000797 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226015 predicted 351
2 SASI_Hs01_00226016 predicted 322
3 SASI_Hs01_00226017 predicted 357
4 SASI_Hs01_00226018 predicted 345
5 SASI_Hs01_00226019 predicted 337
6 SASI_Hs01_00226020 predicted 347
7 SASI_Hs01_00226021 predicted 375
8 SASI_Hs01_00226022 predicted 404
9 SASI_Hs01_00226023 predicted 1132
10 SASI_Hs01_00226024 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012944 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067224 predicted 1056
2 SASI_Rn01_00067225 predicted 271
3 SASI_Rn01_00067226 predicted 491
4 SASI_Rn01_00067227 predicted 682
5 SASI_Rn01_00067228 predicted 964
6 SASI_Rn01_00067229 predicted 435
7 SASI_Rn02_00260512 predicted 1105
8 SASI_Rn01_00067230 predicted 678
9 SASI_Rn01_00067231 predicted 256
10 SASI_Rn01_00067232 predicted 538
11 SASI_Rn01_00067233 predicted 1097
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007878 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044753 predicted 970
2 SASI_Mm01_00044754 predicted 342
3 SASI_Mm01_00044755 predicted 397
4 SASI_Mm01_00044756 predicted 919
5 SASI_Mm01_00044757 predicted 445
6 SASI_Mm01_00044758 predicted 626
7 SASI_Mm01_00044759 predicted 1001
8 SASI_Mm01_00044760 predicted 518
9 SASI_Mm01_00044761 predicted 637
10 SASI_Mm01_00044762 predicted 578
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007878
DRD4 MISSION shRNA Bacterial Glycerol Stock
dopamine receptor D4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007878.2-581s1c1
Sequence:CCGGGAACCGAGACTATGTGGTCTACTCGAGTAGACCACATAGTCTCGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007878.2-644s1c1
Sequence:CCGGACTGCTTTACTGGGCCACTTTCTCGAGAAAGTGGCCCAGTAAAGCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007878.2-149s1c1
Sequence:CCGGGCTGCTCATCGGCTTGGTGTTCTCGAGAACACCAAGCCGATGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007878.2-1137s1c1
Sequence:CCGGACCATCTTCAACGCGGAGTTTCTCGAGAAACTCCGCGTTGAAGATGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007878.2-1001s1c1
Sequence:CCGGCCTGGTGTGTTGGACGCCTTTCTCGAGAAAGGCGTCCAACACACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007878
DRD4 MISSION shRNA shRNA Plasmid DNA
dopamine receptor D4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007878.2-581s1c1
Sequence:CCGGGAACCGAGACTATGTGGTCTACTCGAGTAGACCACATAGTCTCGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007878.2-644s1c1
Sequence:CCGGACTGCTTTACTGGGCCACTTTCTCGAGAAAGTGGCCCAGTAAAGCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007878.2-149s1c1
Sequence:CCGGGCTGCTCATCGGCTTGGTGTTCTCGAGAACACCAAGCCGATGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007878.2-1137s1c1
Sequence:CCGGACCATCTTCAACGCGGAGTTTCTCGAGAAACTCCGCGTTGAAGATGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007878.2-1001s1c1
Sequence:CCGGCCTGGTGTGTTGGACGCCTTTCTCGAGAAAGGCGTCCAACACACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007878
DRD4 MISSION shRNA Lentiviral Transduction Particles
dopamine receptor D4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007878.2-581s1c1
Sequence:CCGGGAACCGAGACTATGTGGTCTACTCGAGTAGACCACATAGTCTCGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007878.2-644s1c1
Sequence:CCGGACTGCTTTACTGGGCCACTTTCTCGAGAAAGTGGCCCAGTAAAGCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007878.2-149s1c1
Sequence:CCGGGCTGCTCATCGGCTTGGTGTTCTCGAGAACACCAAGCCGATGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007878.2-1137s1c1
Sequence:CCGGACCATCTTCAACGCGGAGTTTCTCGAGAAACTCCGCGTTGAAGATGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007878.2-1001s1c1
Sequence:CCGGCCTGGTGTGTTGGACGCCTTTCTCGAGAAAGGCGTCCAACACACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000797
DRD4 MISSION shRNA Bacterial Glycerol Stock
dopamine receptor D4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000797.2-1200s1c1
Sequence:CCGGCACTGTCTTCAACGCCGAGTTCTCGAGAACTCGGCGTTGAAGACAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000797.2-1080s1c1
Sequence:CCGGGCCCTTCTTCGTGGTGCACATCTCGAGATGTGCACCACGAAGAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000797.2-270s1c1
Sequence:CCGGCTTCGTCTACTCCGAGGTCCACTCGAGTGGACCTCGGAGTAGACGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000797.2-627s1c1
Sequence:CCGGGCTGCTCTACTGGGCCACGTTCTCGAGAACGTGGCCCAGTAGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000797.2-504s1c1
Sequence:CCGGGCCCGTACTGTGCGGCCTCAACTCGAGTTGAGGCCGCACAGTACGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000797
DRD4 MISSION shRNA shRNA Plasmid DNA
dopamine receptor D4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000797.2-1200s1c1
Sequence:CCGGCACTGTCTTCAACGCCGAGTTCTCGAGAACTCGGCGTTGAAGACAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000797.2-1080s1c1
Sequence:CCGGGCCCTTCTTCGTGGTGCACATCTCGAGATGTGCACCACGAAGAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000797.2-270s1c1
Sequence:CCGGCTTCGTCTACTCCGAGGTCCACTCGAGTGGACCTCGGAGTAGACGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000797.2-627s1c1
Sequence:CCGGGCTGCTCTACTGGGCCACGTTCTCGAGAACGTGGCCCAGTAGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000797.2-504s1c1
Sequence:CCGGGCCCGTACTGTGCGGCCTCAACTCGAGTTGAGGCCGCACAGTACGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000797
DRD4 MISSION shRNA Lentiviral Transduction Particles
dopamine receptor D4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000797.2-1200s1c1
Sequence:CCGGCACTGTCTTCAACGCCGAGTTCTCGAGAACTCGGCGTTGAAGACAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000797.2-1080s1c1
Sequence:CCGGGCCCTTCTTCGTGGTGCACATCTCGAGATGTGCACCACGAAGAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000797.2-270s1c1
Sequence:CCGGCTTCGTCTACTCCGAGGTCCACTCGAGTGGACCTCGGAGTAGACGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000797.2-627s1c1
Sequence:CCGGGCTGCTCTACTGGGCCACGTTCTCGAGAACGTGGCCCAGTAGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000797.2-504s1c1
Sequence:CCGGGCCCGTACTGTGCGGCCTCAACTCGAGTTGAGGCCGCACAGTACGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks