EMAIL THIS PAGE TO A FRIEND

DRD5

dopamine receptor D5

75 Gene Product Result for
Synonyms: DBDR DRD1B DRD1L2
UniProtKB ID: P21918, B2R9S3, Q8NEQ8
Gene ID:
Human(1816) Summary: This gene encodes the D5 subtype of the dopamine receptor. The D5 subtype is a G-protein coupled receptor which stimulates adenylyl cyclase. This receptor is expressed in neurons in the limbic regions of the brain. It has a 10-fold higher affinity for dopamine than the D1 subtype. Pseudogenes related to this gene reside on chromosomes 1 and 2. [provided by RefSeq, Jul 2008]
Mouse(13492) dopamine receptor D5
Rat(25195) dopamine receptor D5
chicken(428795) dopamine receptor D5
cow(526221) dopamine receptor D5
domestic cat(101091278) dopamine receptor D5
dog(488824) dopamine receptor D5
naked mole-rat(101716828) dopamine receptor D5
domestic guinea pig(100732538) dopamine receptor D5
sheep(101114778) dopamine receptor D5
Domestic Rabbit(100342687) dopamine receptor D5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Precursor

Product # Description Species Add to Cart
 
D9503 3,4-Dihydroxy-DL-phenylalanine human, mouse, rat pricing
D9628 3,4-Dihydroxy-L-phenylalanine ≥98% (TLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013503 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013503 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013503 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000798 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000798 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000798 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU139051 MISSION® esiRNA esiRNA human DRD5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000798 Rosetta Predictions human pricing
NM_012768 Rosetta Predictions rat pricing
NM_013503 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000798 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238505 predicted 1107
2 SASI_Hs01_00238506 predicted 705
3 SASI_Hs01_00238507 predicted 1468
4 SASI_Hs01_00238510 predicted 607
5 SASI_Hs01_00238511 predicted 1265
6 SASI_Hs02_00303244 predicted 529
7 SASI_Hs01_00238512 predicted 1023
8 SASI_Hs01_00238513 predicted 827
9 SASI_Hs01_00238514 predicted 1475
10 SASI_Hs02_00303245 predicted 889
11 SASI_Hs01_00238508 predicted 732
12 SASI_Hs01_00238509 predicted 725
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012768 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040013 predicted 209
2 SASI_Rn01_00040014 predicted 375
3 SASI_Rn01_00040015 predicted 995
4 SASI_Rn01_00040016 predicted 248
5 SASI_Rn01_00040017 predicted 744
6 SASI_Rn01_00040018 predicted 633
7 SASI_Rn01_00040019 predicted 999
8 SASI_Rn02_00260145 predicted 657
9 SASI_Rn01_00040020 predicted 205
10 SASI_Rn01_00040021 predicted 647
11 SASI_Rn01_00040012 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013503 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162447 predicted 1839
2 SASI_Mm01_00162448 predicted 906
3 SASI_Mm01_00162449 predicted 1786
4 SASI_Mm01_00162450 predicted 1771
5 SASI_Mm01_00162451 predicted 526
6 SASI_Mm01_00162452 predicted 659
7 SASI_Mm01_00162453 predicted 869
8 SASI_Mm01_00162455 predicted 1826
9 SASI_Mm01_00162456 predicted 1929
10 SASI_Mm02_00322159 predicted 1981
11 SASI_Mm01_00162454 predicted 1763
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013503
DRD5 MISSION shRNA Bacterial Glycerol Stock
dopamine receptor D5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013503.1-1295s1c1
Sequence:CCGGGCAGACGGTAAACATCAGTAACTCGAGTTACTGATGTTTACCGTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013503.1-1449s1c1
Sequence:CCGGCCTTTCGATCACATGTCTCAACTCGAGTTGAGACATGTGATCGAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013503.1-2250s1c1
Sequence:CCGGGCTGACTTCTTGGATTTCTTTCTCGAGAAAGAAATCCAAGAAGTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013503.1-826s1c1
Sequence:CCGGCGTCGCTCATCAGCTTCTATACTCGAGTATAGAAGCTGATGAGCGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013503.1-1082s1c1
Sequence:CCGGCCTGAACTGTATGGTTCCCTTCTCGAGAAGGGAACCATACAGTTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013503.2-1613s21c1
Sequence:CCGGGTACAGTTGTGGCCATATTTACTCGAGTAAATATGGCCACAACTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013503.2-1153s21c1
Sequence:CCGGCGAGACCACCTTCGACATATTCTCGAGAATATGTCGAAGGTGGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013503.2-826s21c1
Sequence:CCGGGTCGCTCATCAGCTTCTATATCTCGAGATATAGAAGCTGATGAGCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013503.2-669s21c1
Sequence:CCGGTTATCCCGGTCCAACTCAATTCTCGAGAATTGAGTTGGACCGGGATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013503.2-1295s21c1
Sequence:CCGGCAGACGGTAAACATCAGTAATCTCGAGATTACTGATGTTTACCGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013503
DRD5 MISSION shRNA shRNA Plasmid DNA
dopamine receptor D5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013503.1-1295s1c1
Sequence:CCGGGCAGACGGTAAACATCAGTAACTCGAGTTACTGATGTTTACCGTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013503.1-1449s1c1
Sequence:CCGGCCTTTCGATCACATGTCTCAACTCGAGTTGAGACATGTGATCGAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013503.1-2250s1c1
Sequence:CCGGGCTGACTTCTTGGATTTCTTTCTCGAGAAAGAAATCCAAGAAGTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013503.1-826s1c1
Sequence:CCGGCGTCGCTCATCAGCTTCTATACTCGAGTATAGAAGCTGATGAGCGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013503.1-1082s1c1
Sequence:CCGGCCTGAACTGTATGGTTCCCTTCTCGAGAAGGGAACCATACAGTTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013503.2-1613s21c1
Sequence:CCGGGTACAGTTGTGGCCATATTTACTCGAGTAAATATGGCCACAACTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013503.2-1153s21c1
Sequence:CCGGCGAGACCACCTTCGACATATTCTCGAGAATATGTCGAAGGTGGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013503.2-826s21c1
Sequence:CCGGGTCGCTCATCAGCTTCTATATCTCGAGATATAGAAGCTGATGAGCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013503.2-669s21c1
Sequence:CCGGTTATCCCGGTCCAACTCAATTCTCGAGAATTGAGTTGGACCGGGATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013503.2-1295s21c1
Sequence:CCGGCAGACGGTAAACATCAGTAATCTCGAGATTACTGATGTTTACCGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013503
DRD5 MISSION shRNA Lentiviral Transduction Particles
dopamine receptor D5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013503.1-1295s1c1
Sequence:CCGGGCAGACGGTAAACATCAGTAACTCGAGTTACTGATGTTTACCGTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013503.1-1449s1c1
Sequence:CCGGCCTTTCGATCACATGTCTCAACTCGAGTTGAGACATGTGATCGAAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013503.1-2250s1c1
Sequence:CCGGGCTGACTTCTTGGATTTCTTTCTCGAGAAAGAAATCCAAGAAGTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013503.1-826s1c1
Sequence:CCGGCGTCGCTCATCAGCTTCTATACTCGAGTATAGAAGCTGATGAGCGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013503.1-1082s1c1
Sequence:CCGGCCTGAACTGTATGGTTCCCTTCTCGAGAAGGGAACCATACAGTTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013503.2-1613s21c1
Sequence:CCGGGTACAGTTGTGGCCATATTTACTCGAGTAAATATGGCCACAACTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013503.2-1153s21c1
Sequence:CCGGCGAGACCACCTTCGACATATTCTCGAGAATATGTCGAAGGTGGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013503.2-826s21c1
Sequence:CCGGGTCGCTCATCAGCTTCTATATCTCGAGATATAGAAGCTGATGAGCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013503.2-669s21c1
Sequence:CCGGTTATCCCGGTCCAACTCAATTCTCGAGAATTGAGTTGGACCGGGATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013503.2-1295s21c1
Sequence:CCGGCAGACGGTAAACATCAGTAATCTCGAGATTACTGATGTTTACCGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000798
VALIDATED
DRD5 MISSION shRNA Bacterial Glycerol Stock
dopamine receptor D5
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_000798.3-267s1c1
Sequence:CCGGCGCCAACATGACCAACGTCTTCTCGAGAAGACGTTGGTCATGTTGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_000798.3-1353s1c1
Sequence:CCGGCGATCGCATGTTCCAGATCTACTCGAGTAGATCTGGAACATGCGATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000798.3-678s1c1
Sequence:CCGGGCCCGACGTGAATGCAGAGAACTCGAGTTCTCTGCATTCACGTCGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_000798.3-1138s1c1
Sequence:CCGGGCCGACTTTCAGAAGGTGTTTCTCGAGAAACACCTTCTGAAAGTCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_000798.3-1542s1c1
Sequence:CCGGCGCACACACACGCAAATACATCTCGAGATGTATTTGCGTGTGTGTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000798.4-2079s21c1
Sequence:CCGGAGTATGGTGCTGGGTCCTTAACTCGAGTTAAGGACCCAGCACCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000798.4-1472s21c1
Sequence:CCGGATGCCTTCAACGCCGACTTTCCTCGAGGAAAGTCGGCGTTGAAGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000798.4-1593s21c1
Sequence:CCGGCATCGTCTTCCACAAGGAAATCTCGAGATTTCCTTGTGGAAGACGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000798.4-2001s21c1
Sequence:CCGGGGCAGAAGCAGTTGCAATAAACTCGAGTTTATTGCAACTGCTTCTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000798.4-1698s21c1
Sequence:CCGGCGATCGCATGTTCCAGATCTACTCGAGTAGATCTGGAACATGCGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000798.4-1154s21c1
Sequence:CCGGAGGTGCAGATCCGCAGGATTTCTCGAGAAATCCTGCGGATCTGCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000798
VALIDATED
DRD5 MISSION shRNA shRNA Plasmid DNA
dopamine receptor D5
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_000798.3-267s1c1
Sequence:CCGGCGCCAACATGACCAACGTCTTCTCGAGAAGACGTTGGTCATGTTGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_000798.3-1353s1c1
Sequence:CCGGCGATCGCATGTTCCAGATCTACTCGAGTAGATCTGGAACATGCGATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000798.3-678s1c1
Sequence:CCGGGCCCGACGTGAATGCAGAGAACTCGAGTTCTCTGCATTCACGTCGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_000798.3-1138s1c1
Sequence:CCGGGCCGACTTTCAGAAGGTGTTTCTCGAGAAACACCTTCTGAAAGTCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_000798.3-1542s1c1
Sequence:CCGGCGCACACACACGCAAATACATCTCGAGATGTATTTGCGTGTGTGTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000798.4-2079s21c1
Sequence:CCGGAGTATGGTGCTGGGTCCTTAACTCGAGTTAAGGACCCAGCACCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000798.4-1472s21c1
Sequence:CCGGATGCCTTCAACGCCGACTTTCCTCGAGGAAAGTCGGCGTTGAAGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000798.4-1593s21c1
Sequence:CCGGCATCGTCTTCCACAAGGAAATCTCGAGATTTCCTTGTGGAAGACGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000798.4-2001s21c1
Sequence:CCGGGGCAGAAGCAGTTGCAATAAACTCGAGTTTATTGCAACTGCTTCTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000798.4-1698s21c1
Sequence:CCGGCGATCGCATGTTCCAGATCTACTCGAGTAGATCTGGAACATGCGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000798.4-1154s21c1
Sequence:CCGGAGGTGCAGATCCGCAGGATTTCTCGAGAAATCCTGCGGATCTGCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000798
VALIDATED
DRD5 MISSION shRNA Lentiviral Transduction Particles
dopamine receptor D5
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_000798.3-267s1c1
Sequence:CCGGCGCCAACATGACCAACGTCTTCTCGAGAAGACGTTGGTCATGTTGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_000798.3-1353s1c1
Sequence:CCGGCGATCGCATGTTCCAGATCTACTCGAGTAGATCTGGAACATGCGATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000798.3-678s1c1
Sequence:CCGGGCCCGACGTGAATGCAGAGAACTCGAGTTCTCTGCATTCACGTCGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_000798.3-1138s1c1
Sequence:CCGGGCCGACTTTCAGAAGGTGTTTCTCGAGAAACACCTTCTGAAAGTCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_000798.3-1542s1c1
Sequence:CCGGCGCACACACACGCAAATACATCTCGAGATGTATTTGCGTGTGTGTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000798.4-2079s21c1
Sequence:CCGGAGTATGGTGCTGGGTCCTTAACTCGAGTTAAGGACCCAGCACCATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000798.4-1472s21c1
Sequence:CCGGATGCCTTCAACGCCGACTTTCCTCGAGGAAAGTCGGCGTTGAAGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000798.4-1593s21c1
Sequence:CCGGCATCGTCTTCCACAAGGAAATCTCGAGATTTCCTTGTGGAAGACGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000798.4-2001s21c1
Sequence:CCGGGGCAGAAGCAGTTGCAATAAACTCGAGTTTATTGCAACTGCTTCTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000798.4-1698s21c1
Sequence:CCGGCGATCGCATGTTCCAGATCTACTCGAGTAGATCTGGAACATGCGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000798.4-1154s21c1
Sequence:CCGGAGGTGCAGATCCGCAGGATTTCTCGAGAAATCCTGCGGATCTGCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)