EMAIL THIS PAGE TO A FRIEND

DRG2

developmentally regulated GTP binding protein 2

75 Gene Product Result for
UniProtKB ID: P55039, B2R8G5, Q53Y50, Q9BWB2
Gene ID:
Human(1819) Summary: This gene encodes a GTP-binding protein known to function in the regulation of cell growth and differentiation. Read-through transcripts containing this gene and a downstream gene have been identified, but they are not thought to encode a fusion protein. This gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jan 2012]
Mouse(13495) developmentally regulated GTP binding protein 2
Rat(497915) developmentally regulated GTP binding protein 2
naked mole-rat(101700284) developmentally regulated GTP binding protein 2
domestic guinea pig(100732463) developmentally regulated GTP binding protein 2
sheep(101121183) developmentally regulated GTP binding protein 2
Zebrafish(323355) developmentally regulated GTP binding protein 2
chicken(416513) developmentally regulated GTP binding protein 2
dog(479523) developmentally regulated GTP binding protein 2
Horse(100051979) developmentally regulated GTP binding protein 2
cow(507472) developmentally regulated GTP binding protein 2
domestic cat(101100518) developmentally regulated GTP binding protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021354 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021354 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021354 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001388 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001388 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001388 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001388 Rosetta Predictions human pricing
XM_001076012 Rosetta Predictions rat pricing
XM_573102 Rosetta Predictions rat pricing
NM_021354 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001388 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010502 predicted 658
2 SASI_Hs01_00010503 predicted 1337
3 SASI_Hs01_00010504 predicted 253
4 SASI_Hs01_00010506 predicted 472
5 SASI_Hs01_00010507 predicted 1530
6 SASI_Hs01_00010508 predicted 319
7 SASI_Hs01_00010509 predicted 556
8 SASI_Hs02_00331751 predicted 955
9 SASI_Hs02_00331752 predicted 1124
10 SASI_Hs02_00331753 predicted 890
11 SASI_Hs01_00010501 predicted 1263
12 SASI_Hs01_00010505 predicted 882
13 SASI_Hs01_00010510 predicted 218
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076012 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351763 predicted 720
2 SASI_Rn02_00351764 predicted 878
3 SASI_Rn02_00351765 predicted 893
4 SASI_Rn02_00351766 predicted 844
5 SASI_Rn02_00351767 predicted 862
6 SASI_Rn02_00351768 predicted 346
7 SASI_Rn02_00351769 predicted 217
8 SASI_Rn02_00351770 predicted 484
9 SASI_Rn02_00351771 predicted 358
10 SASI_Rn02_00351772 predicted 234
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573102 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399788 predicted 1135
2 SASI_Rn02_00399789 predicted 839
3 SASI_Rn02_00399790 predicted 928
4 SASI_Rn02_00399791 predicted 1047
5 SASI_Rn02_00399792 predicted 863
6 SASI_Rn02_00399793 predicted 338
7 SASI_Rn02_00399794 predicted 219
8 SASI_Rn02_00399795 predicted 479
9 SASI_Rn02_00399796 predicted 356
10 SASI_Rn02_00399797 predicted 883
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021354 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138359 predicted 868
2 SASI_Mm02_00325938 predicted 858
3 SASI_Mm02_00325939 predicted 555
4 SASI_Mm01_00138360 predicted 472
5 SASI_Mm02_00325940 predicted 837
6 SASI_Mm01_00138361 predicted 457
7 SASI_Mm02_00325941 predicted 209
8 SASI_Mm01_00138362 predicted 1142
9 SASI_Mm02_00325942 predicted 329
10 SASI_Mm02_00325943 predicted 720
11 SASI_Mm01_00138363 predicted 715
12 SASI_Mm01_00138364 predicted 604
13 SASI_Mm01_00138365 predicted 1249
14 SASI_Mm01_00138366 predicted 1244
15 SASI_Mm01_00138367 predicted 309
16 SASI_Mm01_00138368 predicted 279
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021354
VALIDATED
DRG2 MISSION shRNA Bacterial Glycerol Stock
developmentally regulated GTP binding protein 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021354.1-1247s1c1
Sequence:CCGGGCGATTCTTGAGTGGCTGATTCTCGAGAATCAGCCACTCAAGAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021354.1-780s1c1
Sequence:CCGGGCCCTGCCTCTATGTGTATAACTCGAGTTATACACATAGAGGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021354.1-851s1c1
Sequence:CCGGCCAACAGTGTAGTTATCAGTTCTCGAGAACTGATAACTACACTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021354.1-335s1c1
Sequence:CCGGCCTATGAGTTTACCACCCTGACTCGAGTCAGGGTGGTAAACTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021354.1-675s1c1
Sequence:CCGGGCTCATCCTACATGAATACAACTCGAGTTGTATTCATGTAGGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354122    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021354.1-1247s21c1
Sequence:CCGGGCGATTCTTGAGTGGCTGATTCTCGAGAATCAGCCACTCAAGAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021354.1-675s21c1
Sequence:CCGGGCTCATCCTACATGAATACAACTCGAGTTGTATTCATGTAGGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021354.1-851s21c1
Sequence:CCGGCCAACAGTGTAGTTATCAGTTCTCGAGAACTGATAACTACACTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021354.1-780s21c1
Sequence:CCGGGCCCTGCCTCTATGTGTATAACTCGAGTTATACACATAGAGGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021354
VALIDATED
DRG2 MISSION shRNA shRNA Plasmid DNA
developmentally regulated GTP binding protein 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021354.1-1247s1c1
Sequence:CCGGGCGATTCTTGAGTGGCTGATTCTCGAGAATCAGCCACTCAAGAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021354.1-780s1c1
Sequence:CCGGGCCCTGCCTCTATGTGTATAACTCGAGTTATACACATAGAGGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021354.1-851s1c1
Sequence:CCGGCCAACAGTGTAGTTATCAGTTCTCGAGAACTGATAACTACACTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021354.1-335s1c1
Sequence:CCGGCCTATGAGTTTACCACCCTGACTCGAGTCAGGGTGGTAAACTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021354.1-675s1c1
Sequence:CCGGGCTCATCCTACATGAATACAACTCGAGTTGTATTCATGTAGGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354122    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021354.1-1247s21c1
Sequence:CCGGGCGATTCTTGAGTGGCTGATTCTCGAGAATCAGCCACTCAAGAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021354.1-675s21c1
Sequence:CCGGGCTCATCCTACATGAATACAACTCGAGTTGTATTCATGTAGGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021354.1-851s21c1
Sequence:CCGGCCAACAGTGTAGTTATCAGTTCTCGAGAACTGATAACTACACTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021354.1-780s21c1
Sequence:CCGGGCCCTGCCTCTATGTGTATAACTCGAGTTATACACATAGAGGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021354
VALIDATED
DRG2 MISSION shRNA Lentiviral Transduction Particles
developmentally regulated GTP binding protein 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021354.1-1247s1c1
Sequence:CCGGGCGATTCTTGAGTGGCTGATTCTCGAGAATCAGCCACTCAAGAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021354.1-780s1c1
Sequence:CCGGGCCCTGCCTCTATGTGTATAACTCGAGTTATACACATAGAGGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021354.1-851s1c1
Sequence:CCGGCCAACAGTGTAGTTATCAGTTCTCGAGAACTGATAACTACACTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021354.1-335s1c1
Sequence:CCGGCCTATGAGTTTACCACCCTGACTCGAGTCAGGGTGGTAAACTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021354.1-675s1c1
Sequence:CCGGGCTCATCCTACATGAATACAACTCGAGTTGTATTCATGTAGGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354122    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021354.1-1247s21c1
Sequence:CCGGGCGATTCTTGAGTGGCTGATTCTCGAGAATCAGCCACTCAAGAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021354.1-675s21c1
Sequence:CCGGGCTCATCCTACATGAATACAACTCGAGTTGTATTCATGTAGGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021354.1-851s21c1
Sequence:CCGGCCAACAGTGTAGTTATCAGTTCTCGAGAACTGATAACTACACTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021354.1-780s21c1
Sequence:CCGGGCCCTGCCTCTATGTGTATAACTCGAGTTATACACATAGAGGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001388
VALIDATED
DRG2 MISSION shRNA Bacterial Glycerol Stock
developmentally regulated GTP binding protein 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001388.3-676s1c1
Sequence:CCGGGCACGAATACAAGATCTTCAACTCGAGTTGAAGATCTTGTATTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001388.3-571s1c1
Sequence:CCGGGCACAAGCCTAACATCTACTTCTCGAGAAGTAGATGTTAGGCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001388.3-772s1c1
Sequence:CCGGGCCCTGCCTGTATGTTTATAACTCGAGTTATAAACATACAGGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001388.3-271s1c1
Sequence:CCGGTGTGGGTAAGTCCACATTCTTCTCGAGAAGAATGTGGACTTACCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001388.3-959s1c1
Sequence:CCGGGACTTCACAGACGCCATCATTCTCGAGAATGATGGCGTCTGTGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001388
VALIDATED
DRG2 MISSION shRNA shRNA Plasmid DNA
developmentally regulated GTP binding protein 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001388.3-676s1c1
Sequence:CCGGGCACGAATACAAGATCTTCAACTCGAGTTGAAGATCTTGTATTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001388.3-571s1c1
Sequence:CCGGGCACAAGCCTAACATCTACTTCTCGAGAAGTAGATGTTAGGCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001388.3-772s1c1
Sequence:CCGGGCCCTGCCTGTATGTTTATAACTCGAGTTATAAACATACAGGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001388.3-271s1c1
Sequence:CCGGTGTGGGTAAGTCCACATTCTTCTCGAGAAGAATGTGGACTTACCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001388.3-959s1c1
Sequence:CCGGGACTTCACAGACGCCATCATTCTCGAGAATGATGGCGTCTGTGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001388
VALIDATED
DRG2 MISSION shRNA Lentiviral Transduction Particles
developmentally regulated GTP binding protein 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001388.3-676s1c1
Sequence:CCGGGCACGAATACAAGATCTTCAACTCGAGTTGAAGATCTTGTATTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001388.3-571s1c1
Sequence:CCGGGCACAAGCCTAACATCTACTTCTCGAGAAGTAGATGTTAGGCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001388.3-772s1c1
Sequence:CCGGGCCCTGCCTGTATGTTTATAACTCGAGTTATAAACATACAGGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001388.3-271s1c1
Sequence:CCGGTGTGGGTAAGTCCACATTCTTCTCGAGAAGAATGTGGACTTACCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001388.3-959s1c1
Sequence:CCGGGACTTCACAGACGCCATCATTCTCGAGAATGATGGCGTCTGTGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks