EMAIL THIS PAGE TO A FRIEND

DROSHA

drosha, ribonuclease type III

Synonyms: ETOHI2 HSA242976 RANSE3L RN3 RNASE3L RNASEN
Gene ID:
Human(29102) Summary: Members of the ribonuclease III superfamily of double-stranded (ds) RNA-specific endoribonucleases participate in diverse RNA maturation and decay pathways in eukaryotic and prokaryotic cells (Fortin et al., 2002 [PubMed 12191433]
Mouse(14000) drosha, ribonuclease type III
Rat(310159) drosha, ribonuclease type III
fruit fly(35747) CG8730 gene product from transcript CG8730-RA
domestic cat(101100622) drosha, ribonuclease type III
cow(540168) drosha, ribonuclease type III
Horse(100054238) drosha, ribonuclease type III
dog(479375) drosha, ribonuclease type III
chicken(420911) drosha, ribonuclease type III
domestic guinea pig(100718211) drosha, ribonuclease type III
naked mole-rat(101726022) drosha, ribonuclease type III
sheep(101115827) drosha, ribonuclease type III
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013235 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013235 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013235 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026799 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026799 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026799 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100412 Rosetta Predictions human pricing
NM_013235 Rosetta Predictions human pricing
NM_001107655 Rosetta Predictions rat pricing
NM_001130149 Rosetta Predictions mouse pricing
NM_026799 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321994 predicted 3305
2 SASI_Hs02_00321995 predicted 4478
3 SASI_Hs02_00321996 predicted 1950
4 SASI_Hs02_00321997 predicted 2011
5 SASI_Hs02_00321998 predicted 4264
6 SASI_Hs02_00321999 predicted 1610
7 SASI_Hs02_00322000 predicted 3011
8 SASI_Hs02_00322001 predicted 2191
9 SASI_Hs02_00322002 predicted 3378
10 SASI_Hs02_00322003 predicted 2424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013235 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171140 predicted 4516
2 SASI_Hs01_00171141 predicted 1992
3 SASI_Hs01_00171142 predicted 2052
4 SASI_Hs01_00171143 predicted 2276
5 SASI_Hs01_00171144 predicted 4294
6 SASI_Hs02_00344427 predicted 2202
7 SASI_Hs02_00344428 predicted 3952
8 SASI_Hs01_00171145 predicted 1646
9 SASI_Hs02_00344429 predicted 2143
10 SASI_Hs01_00171147 predicted 2221
11 SASI_Hs01_00171139 predicted 3233
12 SASI_Hs01_00171146 predicted 2934
13 SASI_Hs01_00171148 predicted 3309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107655 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230965 predicted 2309
2 SASI_Rn02_00230966 predicted 2215
3 SASI_Rn02_00230967 predicted 1939
4 SASI_Rn02_00230968 predicted 2093
5 SASI_Rn02_00230969 predicted 2081
6 SASI_Rn02_00230970 predicted 2016
7 SASI_Rn02_00230971 predicted 1532
8 SASI_Rn02_00230972 predicted 2028
9 SASI_Rn02_00230973 predicted 2108
10 SASI_Rn02_00230974 predicted 1879
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130149 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310848 predicted 2347
2 SASI_Mm02_00310849 predicted 2821
3 SASI_Mm02_00310850 predicted 2633
4 SASI_Mm02_00310851 predicted 1165
5 SASI_Mm02_00310852 predicted 3409
6 SASI_Mm02_00310853 predicted 2568
7 SASI_Mm02_00310854 predicted 2116
8 SASI_Mm02_00310855 predicted 3267
9 SASI_Mm02_00310856 predicted 2905
10 SASI_Mm02_00310857 predicted 3142
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026799 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099868 predicted 2821
2 SASI_Mm01_00099869 predicted 2636
3 SASI_Mm01_00099870 predicted 1211
4 SASI_Mm01_00099871 predicted 3407
5 SASI_Mm01_00099872 predicted 2560
6 SASI_Mm01_00099873 predicted 1315
7 SASI_Mm01_00099875 predicted 2117
8 SASI_Mm01_00099876 predicted 1540
9 SASI_Mm01_00099877 predicted 3258
10 SASI_Mm02_00330928 predicted 2906
11 SASI_Mm01_00099874 predicted 3184
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013235
VALIDATED
DROSHA MISSION shRNA Bacterial Glycerol Stock
drosha, ribonuclease type III
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_013235.4-4504s21c1
Sequence:CCGGGAGTATTTACTTGCTCAGTAACTCGAGTTACTGAGCAAGTAAATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013235.4-4454s21c1
Sequence:CCGGGCCAGATGAGACTGAAGACATCTCGAGATGTCTTCAGTCTCATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_013235.4-3298s21c1
Sequence:CCGGCCAGCGTCCATTTGTACTATTCTCGAGAATAGTACAAATGGACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013235.4-3891s21c1
Sequence:CCGGCGAAGCTCTTTGGTGAATAATCTCGAGATTATTCACCAAAGAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013235.4-3582s21c1
Sequence:CCGGCGCGAAGTCTGGCTCAATTATCTCGAGATAATTGAGCCAGACTTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_013235.2-3777s1c1
Sequence:CCGGCGAAGCTCTTTGGTGAATAATCTCGAGATTATTCACCAAAGAGCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_013235.2-4340s1c1
Sequence:CCGGGCCAGATGAGACTGAAGACATCTCGAGATGTCTTCAGTCTCATCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022249    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_013235.2-4390s1c1
Sequence:CCGGGAGTATTTACTTGCTCAGTAACTCGAGTTACTGAGCAAGTAAATACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_013235.2-3184s1c1
Sequence:CCGGCCAGCGTCCATTTGTACTATTCTCGAGAATAGTACAAATGGACGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013235.2-826s1c1
Sequence:CCGGCCAGTGCTAATAACAGCAGTACTCGAGTACTGCTGTTATTAGCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013235
VALIDATED
DROSHA MISSION shRNA shRNA Plasmid DNA
drosha, ribonuclease type III
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_013235.4-4504s21c1
Sequence:CCGGGAGTATTTACTTGCTCAGTAACTCGAGTTACTGAGCAAGTAAATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013235.4-4454s21c1
Sequence:CCGGGCCAGATGAGACTGAAGACATCTCGAGATGTCTTCAGTCTCATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_013235.4-3298s21c1
Sequence:CCGGCCAGCGTCCATTTGTACTATTCTCGAGAATAGTACAAATGGACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013235.4-3891s21c1
Sequence:CCGGCGAAGCTCTTTGGTGAATAATCTCGAGATTATTCACCAAAGAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013235.4-3582s21c1
Sequence:CCGGCGCGAAGTCTGGCTCAATTATCTCGAGATAATTGAGCCAGACTTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_013235.2-3777s1c1
Sequence:CCGGCGAAGCTCTTTGGTGAATAATCTCGAGATTATTCACCAAAGAGCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_013235.2-4340s1c1
Sequence:CCGGGCCAGATGAGACTGAAGACATCTCGAGATGTCTTCAGTCTCATCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022249    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_013235.2-4390s1c1
Sequence:CCGGGAGTATTTACTTGCTCAGTAACTCGAGTTACTGAGCAAGTAAATACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_013235.2-3184s1c1
Sequence:CCGGCCAGCGTCCATTTGTACTATTCTCGAGAATAGTACAAATGGACGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013235.2-826s1c1
Sequence:CCGGCCAGTGCTAATAACAGCAGTACTCGAGTACTGCTGTTATTAGCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013235
VALIDATED
DROSHA MISSION shRNA Lentiviral Transduction Particles
drosha, ribonuclease type III
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_013235.4-4504s21c1
Sequence:CCGGGAGTATTTACTTGCTCAGTAACTCGAGTTACTGAGCAAGTAAATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013235.4-4454s21c1
Sequence:CCGGGCCAGATGAGACTGAAGACATCTCGAGATGTCTTCAGTCTCATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_013235.4-3298s21c1
Sequence:CCGGCCAGCGTCCATTTGTACTATTCTCGAGAATAGTACAAATGGACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013235.4-3891s21c1
Sequence:CCGGCGAAGCTCTTTGGTGAATAATCTCGAGATTATTCACCAAAGAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013235.4-3582s21c1
Sequence:CCGGCGCGAAGTCTGGCTCAATTATCTCGAGATAATTGAGCCAGACTTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_013235.2-3777s1c1
Sequence:CCGGCGAAGCTCTTTGGTGAATAATCTCGAGATTATTCACCAAAGAGCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_013235.2-4340s1c1
Sequence:CCGGGCCAGATGAGACTGAAGACATCTCGAGATGTCTTCAGTCTCATCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022249    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_013235.2-4390s1c1
Sequence:CCGGGAGTATTTACTTGCTCAGTAACTCGAGTTACTGAGCAAGTAAATACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_013235.2-3184s1c1
Sequence:CCGGCCAGCGTCCATTTGTACTATTCTCGAGAATAGTACAAATGGACGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013235.2-826s1c1
Sequence:CCGGCCAGTGCTAATAACAGCAGTACTCGAGTACTGCTGTTATTAGCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026799
VALIDATED
DROSHA MISSION shRNA Bacterial Glycerol Stock
drosha, ribonuclease type III
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026799.2-3139s1c1
Sequence:CCGGCTTCGAGAAGTCTGGCTCAATCTCGAGATTGAGCCAGACTTCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026799.2-1242s1c1
Sequence:CCGGCCGTGATTTGTATGACAAATTCTCGAGAATTTGTCATACAAATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026799.2-3618s1c1
Sequence:CCGGCCTGGAATATGTCCACACTTTCTCGAGAAAGTGTGGACATATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026799.2-1815s1c1
Sequence:CCGGCGAAGAGATGATGCCTGAGAACTCGAGTTCTCAGGCATCATCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026799.2-2553s1c1
Sequence:CCGGCCTGGACAAGTTGATAGGATACTCGAGTATCCTATCAACTTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026799
VALIDATED
DROSHA MISSION shRNA shRNA Plasmid DNA
drosha, ribonuclease type III
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026799.2-3139s1c1
Sequence:CCGGCTTCGAGAAGTCTGGCTCAATCTCGAGATTGAGCCAGACTTCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026799.2-1242s1c1
Sequence:CCGGCCGTGATTTGTATGACAAATTCTCGAGAATTTGTCATACAAATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026799.2-3618s1c1
Sequence:CCGGCCTGGAATATGTCCACACTTTCTCGAGAAAGTGTGGACATATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026799.2-1815s1c1
Sequence:CCGGCGAAGAGATGATGCCTGAGAACTCGAGTTCTCAGGCATCATCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026799.2-2553s1c1
Sequence:CCGGCCTGGACAAGTTGATAGGATACTCGAGTATCCTATCAACTTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026799
VALIDATED
DROSHA MISSION shRNA Lentiviral Transduction Particles
drosha, ribonuclease type III
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026799.2-3139s1c1
Sequence:CCGGCTTCGAGAAGTCTGGCTCAATCTCGAGATTGAGCCAGACTTCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026799.2-1242s1c1
Sequence:CCGGCCGTGATTTGTATGACAAATTCTCGAGAATTTGTCATACAAATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026799.2-3618s1c1
Sequence:CCGGCCTGGAATATGTCCACACTTTCTCGAGAAAGTGTGGACATATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026799.2-1815s1c1
Sequence:CCGGCGAAGAGATGATGCCTGAGAACTCGAGTTCTCAGGCATCATCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026799.2-2553s1c1
Sequence:CCGGCCTGGACAAGTTGATAGGATACTCGAGTATCCTATCAACTTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks