EMAIL THIS PAGE TO A FRIEND

DRP2

dystrophin related protein 2

72 Gene Product Result for
UniProtKB ID: Q13474, A6ZKI5, A8K1B0, B1B1F3, B4DIZ0
Gene ID:
Human(1821) Summary: Members of the dystrophin family of proteins perform a critical role in the maintenance of membrane-associated complexes at points of intercellular contact in vertebrate cells. The protein encoded by this gene is predicted to resemble certain short C-terminal isoforms of dystrophin and dystrophin-related protein 1 (DRP1 or utrophin). DRP2 is expressed principally in the brain and spinal cord. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
Mouse(13497) dystrophin related protein 2
Rat(66027) dystrophin related protein 2
Zebrafish(558055) dystrophin related protein 2
cow(537422) dystrophin related protein 2
Horse(100057542) dystrophin related protein 2
domestic cat(101087136) dystrophin related protein 2
dog(480984) dystrophin related protein 2
chicken(422193) dystrophin related protein 2
sheep(101104809) dystrophin related protein 2
naked mole-rat(101716635) dystrophin related protein 2
domestic guinea pig(100718033) dystrophin related protein 2
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010078 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010078 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010078 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001939 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001939 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001939 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001939 Rosetta Predictions human pricing
NM_023971 Rosetta Predictions rat pricing
NM_010078 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001939 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035777 predicted 799
2 SASI_Hs02_00332845 predicted 2882
3 SASI_Hs01_00035779 predicted 1225
4 SASI_Hs01_00035780 predicted 1356
5 SASI_Hs01_00035781 predicted 2079
6 SASI_Hs02_00332846 predicted 1264
7 SASI_Hs01_00035782 predicted 953
8 SASI_Hs02_00332847 predicted 1313
9 SASI_Hs01_00035783 predicted 1825
10 SASI_Hs01_00035784 predicted 1790
11 SASI_Hs01_00035776 predicted 1303
12 SASI_Hs01_00035778 predicted 1043
13 SASI_Hs01_00035785 predicted 2558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023971 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065152 predicted 1235
2 SASI_Rn01_00065153 predicted 1085
3 SASI_Rn01_00065154 predicted 1974
4 SASI_Rn01_00065155 predicted 704
5 SASI_Rn01_00065156 predicted 1462
6 SASI_Rn01_00065157 predicted 1725
7 SASI_Rn01_00065159 predicted 1514
8 SASI_Rn02_00263779 predicted 808
9 SASI_Rn01_00065160 predicted 2151
10 SASI_Rn02_00263780 predicted 1098
11 SASI_Rn01_00065158 predicted 1991
12 SASI_Rn01_00065161 predicted 566
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010078 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108060 predicted 2301
2 SASI_Mm02_00317760 predicted 1940
3 SASI_Mm01_00108061 predicted 1955
4 SASI_Mm01_00108062 predicted 1011
5 SASI_Mm01_00108063 predicted 910
6 SASI_Mm01_00108064 predicted 1695
7 SASI_Mm01_00108066 predicted 2046
8 SASI_Mm01_00108067 predicted 1130
9 SASI_Mm01_00108068 predicted 2589
10 SASI_Mm01_00108069 predicted 2182
11 SASI_Mm01_00108065 predicted 1581
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010078
DRP2 MISSION shRNA Bacterial Glycerol Stock
dystrophin related protein 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010078.1-412s1c1
Sequence:CCGGGCCATGAATCTGTGTTGGAATCTCGAGATTCCAACACAGATTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010078.1-1429s1c1
Sequence:CCGGCGCCTGGATCTGGTAACTTTACTCGAGTAAAGTTACCAGATCCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010078.1-2188s1c1
Sequence:CCGGGCCACAACCTTAAAGAATAAACTCGAGTTTATTCTTTAAGGTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010078.1-1981s1c1
Sequence:CCGGGCTGAGCAAGTGAAGCATCAACTCGAGTTGATGCTTCACTTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010078.3-2380s21c1
Sequence:CCGGCTGACACACACTCTCGAATTGCTCGAGCAATTCGAGAGTGTGTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010078.3-1049s21c1
Sequence:CCGGTATCCAAGCCATCAAGCTATTCTCGAGAATAGCTTGATGGCTTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010078.3-917s21c1
Sequence:CCGGGCATACTCTGGAACATCTATTCTCGAGAATAGATGTTCCAGAGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010078
DRP2 MISSION shRNA shRNA Plasmid DNA
dystrophin related protein 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010078.1-412s1c1
Sequence:CCGGGCCATGAATCTGTGTTGGAATCTCGAGATTCCAACACAGATTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010078.1-1429s1c1
Sequence:CCGGCGCCTGGATCTGGTAACTTTACTCGAGTAAAGTTACCAGATCCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010078.1-2188s1c1
Sequence:CCGGGCCACAACCTTAAAGAATAAACTCGAGTTTATTCTTTAAGGTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010078.1-1981s1c1
Sequence:CCGGGCTGAGCAAGTGAAGCATCAACTCGAGTTGATGCTTCACTTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010078.3-2380s21c1
Sequence:CCGGCTGACACACACTCTCGAATTGCTCGAGCAATTCGAGAGTGTGTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010078.3-1049s21c1
Sequence:CCGGTATCCAAGCCATCAAGCTATTCTCGAGAATAGCTTGATGGCTTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010078.3-917s21c1
Sequence:CCGGGCATACTCTGGAACATCTATTCTCGAGAATAGATGTTCCAGAGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010078
DRP2 MISSION shRNA Lentiviral Transduction Particles
dystrophin related protein 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010078.1-412s1c1
Sequence:CCGGGCCATGAATCTGTGTTGGAATCTCGAGATTCCAACACAGATTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010078.1-1429s1c1
Sequence:CCGGCGCCTGGATCTGGTAACTTTACTCGAGTAAAGTTACCAGATCCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010078.1-2188s1c1
Sequence:CCGGGCCACAACCTTAAAGAATAAACTCGAGTTTATTCTTTAAGGTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010078.1-1981s1c1
Sequence:CCGGGCTGAGCAAGTGAAGCATCAACTCGAGTTGATGCTTCACTTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010078.3-2380s21c1
Sequence:CCGGCTGACACACACTCTCGAATTGCTCGAGCAATTCGAGAGTGTGTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010078.3-1049s21c1
Sequence:CCGGTATCCAAGCCATCAAGCTATTCTCGAGAATAGCTTGATGGCTTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010078.3-917s21c1
Sequence:CCGGGCATACTCTGGAACATCTATTCTCGAGAATAGATGTTCCAGAGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001939
DRP2 MISSION shRNA Bacterial Glycerol Stock
dystrophin related protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001939.1-492s1c1
Sequence:CCGGCCTAAGCCTAAAGCTGTTGAACTCGAGTTCAACAGCTTTAGGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001939.1-859s1c1
Sequence:CCGGCCTCATTCTGAGAGCAAAGATCTCGAGATCTTTGCTCTCAGAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001939.1-2133s1c1
Sequence:CCGGGCATCAGACCAAGTGCTCTATCTCGAGATAGAGCACTTGGTCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001939.1-2834s1c1
Sequence:CCGGCCCGTATCCTTCGGCAACATACTCGAGTATGTTGCCGAAGGATACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001939.1-1567s1c1
Sequence:CCGGCGCTTGGACCTGGTAACTTTACTCGAGTAAAGTTACCAGGTCCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001939.2-2370s21c1
Sequence:CCGGGGACTTTGCCACAACCTTAAACTCGAGTTTAAGGTTGTGGCAAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001939.2-3478s21c1
Sequence:CCGGGTTCGAGATCAGCCCTTTAAGCTCGAGCTTAAAGGGCTGATCTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001939.2-3617s21c1
Sequence:CCGGGAAAGAGAGAAGCCTAATTACCTCGAGGTAATTAGGCTTCTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001939.2-1177s21c1
Sequence:CCGGGAGCACATCCAGGCTATTAAGCTCGAGCTTAATAGCCTGGATGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001939
DRP2 MISSION shRNA shRNA Plasmid DNA
dystrophin related protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001939.1-492s1c1
Sequence:CCGGCCTAAGCCTAAAGCTGTTGAACTCGAGTTCAACAGCTTTAGGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001939.1-859s1c1
Sequence:CCGGCCTCATTCTGAGAGCAAAGATCTCGAGATCTTTGCTCTCAGAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001939.1-2133s1c1
Sequence:CCGGGCATCAGACCAAGTGCTCTATCTCGAGATAGAGCACTTGGTCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001939.1-2834s1c1
Sequence:CCGGCCCGTATCCTTCGGCAACATACTCGAGTATGTTGCCGAAGGATACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001939.1-1567s1c1
Sequence:CCGGCGCTTGGACCTGGTAACTTTACTCGAGTAAAGTTACCAGGTCCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001939.2-2370s21c1
Sequence:CCGGGGACTTTGCCACAACCTTAAACTCGAGTTTAAGGTTGTGGCAAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001939.2-3478s21c1
Sequence:CCGGGTTCGAGATCAGCCCTTTAAGCTCGAGCTTAAAGGGCTGATCTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001939.2-3617s21c1
Sequence:CCGGGAAAGAGAGAAGCCTAATTACCTCGAGGTAATTAGGCTTCTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001939.2-1177s21c1
Sequence:CCGGGAGCACATCCAGGCTATTAAGCTCGAGCTTAATAGCCTGGATGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001939
DRP2 MISSION shRNA Lentiviral Transduction Particles
dystrophin related protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001939.1-492s1c1
Sequence:CCGGCCTAAGCCTAAAGCTGTTGAACTCGAGTTCAACAGCTTTAGGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001939.1-859s1c1
Sequence:CCGGCCTCATTCTGAGAGCAAAGATCTCGAGATCTTTGCTCTCAGAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001939.1-2133s1c1
Sequence:CCGGGCATCAGACCAAGTGCTCTATCTCGAGATAGAGCACTTGGTCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001939.1-2834s1c1
Sequence:CCGGCCCGTATCCTTCGGCAACATACTCGAGTATGTTGCCGAAGGATACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001939.1-1567s1c1
Sequence:CCGGCGCTTGGACCTGGTAACTTTACTCGAGTAAAGTTACCAGGTCCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001939.2-2370s21c1
Sequence:CCGGGGACTTTGCCACAACCTTAAACTCGAGTTTAAGGTTGTGGCAAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001939.2-3478s21c1
Sequence:CCGGGTTCGAGATCAGCCCTTTAAGCTCGAGCTTAAAGGGCTGATCTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001939.2-3617s21c1
Sequence:CCGGGAAAGAGAGAAGCCTAATTACCTCGAGGTAATTAGGCTTCTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001939.2-1177s21c1
Sequence:CCGGGAGCACATCCAGGCTATTAAGCTCGAGCTTAATAGCCTGGATGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks