EMAIL THIS PAGE TO A FRIEND

DSC1

desmocollin 1

Synonyms: CDHF1 DG2/DG3
UniProtKB ID: Q08554, Q9HB01
Gene ID:
Human(1823) Summary: The protein encoded by this gene is a calcium-dependent glycoprotein that is a member of the desmocollin subfamily of the cadherin superfamily. These desmosomal family members, along with the desmogleins, are found primarily in epithelial cells where they constitute the adhesive proteins of the desmosome cell-cell junction and are required for cell adhesion and desmosome formation. The desmosomal family members are arranged in two clusters on chromosome 18, occupying less than 650 kb combined. Alternative splicing results in two transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(13505) desmocollin 1
Rat(291759) desmocollin 1
domestic cat(101083463) desmocollin 1
cow(281127) desmocollin 1
Horse(100065884) desmocollin 1
dog(490501) desmocollin 1
sheep(101115748) desmocollin 1
Gene Class: Cell_Adhesion
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004948 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004948 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004948 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013504 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013504 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013504 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU077291 MISSION® esiRNA esiRNA human DSC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004948 Rosetta Predictions human pricing
NM_024421 Rosetta Predictions human pricing
NM_001106161 Rosetta Predictions rat pricing
NM_013504 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004948 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172856 predicted 388
2 SASI_Hs02_00338620 predicted 732
3 SASI_Hs01_00172858 predicted 1321
4 SASI_Hs01_00172859 predicted 2216
5 SASI_Hs01_00172860 predicted 1127
6 SASI_Hs01_00172861 predicted 2336
7 SASI_Hs02_00338621 predicted 888
8 SASI_Hs01_00172862 predicted 1206
9 SASI_Hs01_00172863 predicted 1524
10 SASI_Hs01_00172864 predicted 351
11 SASI_Hs01_00172857 predicted 1273
12 SASI_Hs01_00172865 predicted 613
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024421 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020501 predicted 3043
2 SASI_Hs01_00020502 predicted 385
3 SASI_Hs02_00356736 predicted 731
4 SASI_Hs01_00020504 predicted 1323
5 SASI_Hs02_00356737 predicted 2219
6 SASI_Hs01_00020505 predicted 1130
7 SASI_Hs01_00020506 predicted 2338
8 SASI_Hs01_00020507 predicted 1205
9 SASI_Hs01_00020508 predicted 1527
10 SASI_Hs01_00020509 predicted 345
11 SASI_Hs01_00020503 predicted 1280
12 SASI_Hs01_00020510 predicted 613
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106161 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216228 predicted 1216
2 SASI_Rn02_00216229 predicted 1551
3 SASI_Rn02_00216230 predicted 1208
4 SASI_Rn02_00216231 predicted 1178
5 SASI_Rn02_00216232 predicted 1588
6 SASI_Rn02_00216233 predicted 1530
7 SASI_Rn02_00216234 predicted 1747
8 SASI_Rn02_00216235 predicted 1888
9 SASI_Rn02_00216236 predicted 1259
10 SASI_Rn02_00216237 predicted 1235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013504 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024562 predicted 943
2 SASI_Mm01_00024564 predicted 2041
3 SASI_Mm01_00024565 predicted 1509
4 SASI_Mm01_00024566 predicted 741
5 SASI_Mm01_00024567 predicted 431
6 SASI_Mm01_00024568 predicted 807
7 SASI_Mm01_00024569 predicted 1735
8 SASI_Mm01_00024570 predicted 622
9 SASI_Mm01_00024571 predicted 589
10 SASI_Mm02_00322160 predicted 1262
11 SASI_Mm01_00024563 predicted 1666
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004948
DSC1 MISSION shRNA Bacterial Glycerol Stock
desmocollin 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004948.3-1625s21c1
Sequence:CCGGACTACAACTGTCACCGTTAAACTCGAGTTTAACGGTGACAGTTGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004948.3-2840s21c1
Sequence:CCGGAGACTACGTTTGTTCGTATAACTCGAGTTATACGAACAAACGTAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004948.2-1523s1c1
Sequence:CCGGCCATTGAACTATGAAGTCAATCTCGAGATTGACTTCATAGTTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004948.2-749s1c1
Sequence:CCGGGCACAGAATTACACCATCTTTCTCGAGAAAGATGGTGTAATTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004948.2-1754s1c1
Sequence:CCGGCCGGAAATATCCAGTGGTGAACTCGAGTTCACCACTGGATATTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004948.2-1982s1c1
Sequence:CCGGGCACCTCAAATTGACAAAGAACTCGAGTTCTTTGTCAATTTGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004948.2-389s1c1
Sequence:CCGGGCTGAAACACTTGTAGGCAAACTCGAGTTTGCCTACAAGTGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004948
DSC1 MISSION shRNA shRNA Plasmid DNA
desmocollin 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004948.3-1625s21c1
Sequence:CCGGACTACAACTGTCACCGTTAAACTCGAGTTTAACGGTGACAGTTGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004948.3-2840s21c1
Sequence:CCGGAGACTACGTTTGTTCGTATAACTCGAGTTATACGAACAAACGTAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004948.2-1523s1c1
Sequence:CCGGCCATTGAACTATGAAGTCAATCTCGAGATTGACTTCATAGTTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004948.2-749s1c1
Sequence:CCGGGCACAGAATTACACCATCTTTCTCGAGAAAGATGGTGTAATTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004948.2-1754s1c1
Sequence:CCGGCCGGAAATATCCAGTGGTGAACTCGAGTTCACCACTGGATATTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004948.2-1982s1c1
Sequence:CCGGGCACCTCAAATTGACAAAGAACTCGAGTTCTTTGTCAATTTGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004948.2-389s1c1
Sequence:CCGGGCTGAAACACTTGTAGGCAAACTCGAGTTTGCCTACAAGTGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004948
DSC1 MISSION shRNA Lentiviral Transduction Particles
desmocollin 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004948.3-1625s21c1
Sequence:CCGGACTACAACTGTCACCGTTAAACTCGAGTTTAACGGTGACAGTTGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004948.3-2840s21c1
Sequence:CCGGAGACTACGTTTGTTCGTATAACTCGAGTTATACGAACAAACGTAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004948.2-1523s1c1
Sequence:CCGGCCATTGAACTATGAAGTCAATCTCGAGATTGACTTCATAGTTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004948.2-749s1c1
Sequence:CCGGGCACAGAATTACACCATCTTTCTCGAGAAAGATGGTGTAATTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004948.2-1754s1c1
Sequence:CCGGCCGGAAATATCCAGTGGTGAACTCGAGTTCACCACTGGATATTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004948.2-1982s1c1
Sequence:CCGGGCACCTCAAATTGACAAAGAACTCGAGTTCTTTGTCAATTTGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004948.2-389s1c1
Sequence:CCGGGCTGAAACACTTGTAGGCAAACTCGAGTTTGCCTACAAGTGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013504
DSC1 MISSION shRNA Bacterial Glycerol Stock
desmocollin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094069    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013504.2-2692s1c1
Sequence:CCGGCCATATAACTATGAAGGCAAACTCGAGTTTGCCTTCATAGTTATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013504.2-665s1c1
Sequence:CCGGGCCTTACAATTTGTTCTACATCTCGAGATGTAGAACAAATTGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013504.2-2301s1c1
Sequence:CCGGCCAGATGATGTAGCTCAGCAACTCGAGTTGCTGAGCTACATCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013504.2-2178s1c1
Sequence:CCGGCCAAATATAATCCTTGGGAAACTCGAGTTTCCCAAGGATTATATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013504.2-1177s1c1
Sequence:CCGGCGCCATACTTCACCCAAACTTCTCGAGAAGTTTGGGTGAAGTATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013504
DSC1 MISSION shRNA shRNA Plasmid DNA
desmocollin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094069    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013504.2-2692s1c1
Sequence:CCGGCCATATAACTATGAAGGCAAACTCGAGTTTGCCTTCATAGTTATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013504.2-665s1c1
Sequence:CCGGGCCTTACAATTTGTTCTACATCTCGAGATGTAGAACAAATTGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013504.2-2301s1c1
Sequence:CCGGCCAGATGATGTAGCTCAGCAACTCGAGTTGCTGAGCTACATCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013504.2-2178s1c1
Sequence:CCGGCCAAATATAATCCTTGGGAAACTCGAGTTTCCCAAGGATTATATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013504.2-1177s1c1
Sequence:CCGGCGCCATACTTCACCCAAACTTCTCGAGAAGTTTGGGTGAAGTATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013504
DSC1 MISSION shRNA Lentiviral Transduction Particles
desmocollin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094069    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013504.2-2692s1c1
Sequence:CCGGCCATATAACTATGAAGGCAAACTCGAGTTTGCCTTCATAGTTATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013504.2-665s1c1
Sequence:CCGGGCCTTACAATTTGTTCTACATCTCGAGATGTAGAACAAATTGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013504.2-2301s1c1
Sequence:CCGGCCAGATGATGTAGCTCAGCAACTCGAGTTGCTGAGCTACATCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013504.2-2178s1c1
Sequence:CCGGCCAAATATAATCCTTGGGAAACTCGAGTTTCCCAAGGATTATATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013504.2-1177s1c1
Sequence:CCGGCGCCATACTTCACCCAAACTTCTCGAGAAGTTTGGGTGAAGTATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks