EMAIL THIS PAGE TO A FRIEND

DSC2

desmocollin 2

74 Gene Product Result for
Synonyms: ARVD11 CDHF2 DG2 DGII/III DSC3
UniProtKB ID: Q02487
Gene ID:
Human(1824) Summary: The protein encoded by this gene is a calcium-dependent glycoprotein that is a member of the desmocollin subfamily of the cadherin superfamily. These desmosomal family members, along with the desmogleins, are found primarily in epithelial cells where they constitute the adhesive proteins of the desmosome cell-cell junction and are required for cell adhesion and desmosome formation. The desmosomal family members are arranged in two clusters on chromosome 18, occupying less than 650 kb combined. Mutations in this gene are associated with arrhythmogenic right ventricular dysplasia-11. Alternative splicing results in two transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(13506) desmocollin 2
Rat(291760) desmocollin 2
sheep(101116192) desmocollin 2
chicken(428527) desmocollin 2
cow(281128) desmocollin 2
Horse(100065829) desmocollin 2
domestic cat(101085157) desmocollin 2
dog(403860) desmocollin 2
Gene Class: Cell_Adhesion
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013505 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013505 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013505 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004949 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004949 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004949 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU157951 MISSION® esiRNA esiRNA human DSC2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004949 Rosetta Predictions human pricing
NM_024422 Rosetta Predictions human pricing
NM_001033688 Rosetta Predictions rat pricing
NM_013505 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004949 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078700 predicted 1744
2 SASI_Hs02_00338622 predicted 1030
3 SASI_Hs01_00078701 predicted 2382
4 SASI_Hs02_00338623 predicted 729
5 SASI_Hs02_00338624 predicted 2477
6 SASI_Hs02_00338625 predicted 2442
7 SASI_Hs01_00078702 predicted 702
8 SASI_Hs01_00078704 predicted 2407
9 SASI_Hs01_00078706 predicted 848
10 SASI_Hs01_00078707 predicted 1457
11 SASI_Hs01_00078703 predicted 952
12 SASI_Hs01_00078705 predicted 612
13 SASI_Hs01_00078708 predicted 516
14 SASI_Hs01_00078709 predicted 853
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024422 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089519 predicted 1743
2 SASI_Hs02_00356738 predicted 1032
3 SASI_Hs01_00089520 predicted 2375
4 SASI_Hs02_00356739 predicted 737
5 SASI_Hs02_00356740 predicted 2484
6 SASI_Hs02_00356741 predicted 2443
7 SASI_Hs01_00089521 predicted 696
8 SASI_Hs01_00089523 predicted 2405
9 SASI_Hs01_00089525 predicted 849
10 SASI_Hs01_00089526 predicted 1463
11 SASI_Hs01_00089522 predicted 952
12 SASI_Hs01_00089524 predicted 610
13 SASI_Hs01_00089527 predicted 513
14 SASI_Hs01_00089528 predicted 851
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033688 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032014 predicted 2158
2 SASI_Rn01_00032015 predicted 2929
3 SASI_Rn01_00032016 predicted 865
4 SASI_Rn01_00032017 predicted 1683
5 SASI_Rn01_00032019 predicted 805
6 SASI_Rn01_00032020 predicted 1517
7 SASI_Rn01_00032021 predicted 2775
8 SASI_Rn01_00032023 predicted 1290
9 SASI_Rn02_00203700 predicted 1472
10 SASI_Rn02_00203701 predicted 814
11 SASI_Rn01_00032018 predicted 773
12 SASI_Rn01_00032022 predicted 1773
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013505 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083945 predicted 1197
2 SASI_Mm01_00083946 predicted 2234
3 SASI_Mm01_00083947 predicted 1228
4 SASI_Mm02_00322161 predicted 1316
5 SASI_Mm01_00083948 predicted 1513
6 SASI_Mm01_00083949 predicted 2441
7 SASI_Mm01_00083950 predicted 2715
8 SASI_Mm01_00083951 predicted 2301
9 SASI_Mm01_00083952 predicted 2335
10 SASI_Mm01_00083953 predicted 2119
11 SASI_Mm01_00083954 predicted 668
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013505
VALIDATED
DSC2 MISSION shRNA Bacterial Glycerol Stock
desmocollin 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013505.2-2516s1c1
Sequence:CCGGCGGCTTGACAACTCAAACTATCTCGAGATAGTTTGAGTTGTCAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094119    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013505.2-3299s1c1
Sequence:CCGGGCCAACTTATAGTGCAATAAACTCGAGTTTATTGCACTATAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013505.2-1549s1c1
Sequence:CCGGCCCTGCAAATTGGAGTAGTTACTCGAGTAACTACTCCAATTTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013505.2-2069s1c1
Sequence:CCGGCCCACCATTTGATTTCAGTTTCTCGAGAAACTGAAATCAAATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013505.2-2068s1c1
Sequence:CCGGGCCCACCATTTGATTTCAGTTCTCGAGAACTGAAATCAAATGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013505.3-963s21c1
Sequence:CCGGACGATAATTACCCGATCTTTACTCGAGTAAAGATCGGGTAATTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013505.3-1714s21c1
Sequence:CCGGGACTAGAAATGATGGATATAACTCGAGTTATATCCATCATTTCTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013505.3-3298s21c1
Sequence:CCGGGCCAACTTATAGTGCAATAAACTCGAGTTTATTGCACTATAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013505.3-2068s21c1
Sequence:CCGGCCCACCATTTGATTTCAGTTTCTCGAGAAACTGAAATCAAATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013505.3-2515s21c1
Sequence:CCGGCGGCTTGACAACTCAAACTATCTCGAGATAGTTTGAGTTGTCAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013505
VALIDATED
DSC2 MISSION shRNA shRNA Plasmid DNA
desmocollin 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013505.2-2516s1c1
Sequence:CCGGCGGCTTGACAACTCAAACTATCTCGAGATAGTTTGAGTTGTCAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094119    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013505.2-3299s1c1
Sequence:CCGGGCCAACTTATAGTGCAATAAACTCGAGTTTATTGCACTATAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013505.2-1549s1c1
Sequence:CCGGCCCTGCAAATTGGAGTAGTTACTCGAGTAACTACTCCAATTTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013505.2-2069s1c1
Sequence:CCGGCCCACCATTTGATTTCAGTTTCTCGAGAAACTGAAATCAAATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013505.2-2068s1c1
Sequence:CCGGGCCCACCATTTGATTTCAGTTCTCGAGAACTGAAATCAAATGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013505.3-963s21c1
Sequence:CCGGACGATAATTACCCGATCTTTACTCGAGTAAAGATCGGGTAATTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013505.3-1714s21c1
Sequence:CCGGGACTAGAAATGATGGATATAACTCGAGTTATATCCATCATTTCTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013505.3-3298s21c1
Sequence:CCGGGCCAACTTATAGTGCAATAAACTCGAGTTTATTGCACTATAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013505.3-2068s21c1
Sequence:CCGGCCCACCATTTGATTTCAGTTTCTCGAGAAACTGAAATCAAATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013505.3-2515s21c1
Sequence:CCGGCGGCTTGACAACTCAAACTATCTCGAGATAGTTTGAGTTGTCAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013505
VALIDATED
DSC2 MISSION shRNA Lentiviral Transduction Particles
desmocollin 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013505.2-2516s1c1
Sequence:CCGGCGGCTTGACAACTCAAACTATCTCGAGATAGTTTGAGTTGTCAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094119    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013505.2-3299s1c1
Sequence:CCGGGCCAACTTATAGTGCAATAAACTCGAGTTTATTGCACTATAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013505.2-1549s1c1
Sequence:CCGGCCCTGCAAATTGGAGTAGTTACTCGAGTAACTACTCCAATTTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013505.2-2069s1c1
Sequence:CCGGCCCACCATTTGATTTCAGTTTCTCGAGAAACTGAAATCAAATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013505.2-2068s1c1
Sequence:CCGGGCCCACCATTTGATTTCAGTTCTCGAGAACTGAAATCAAATGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013505.3-963s21c1
Sequence:CCGGACGATAATTACCCGATCTTTACTCGAGTAAAGATCGGGTAATTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013505.3-1714s21c1
Sequence:CCGGGACTAGAAATGATGGATATAACTCGAGTTATATCCATCATTTCTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013505.3-3298s21c1
Sequence:CCGGGCCAACTTATAGTGCAATAAACTCGAGTTTATTGCACTATAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013505.3-2068s21c1
Sequence:CCGGCCCACCATTTGATTTCAGTTTCTCGAGAAACTGAAATCAAATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013505.3-2515s21c1
Sequence:CCGGCGGCTTGACAACTCAAACTATCTCGAGATAGTTTGAGTTGTCAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004949
DSC2 MISSION shRNA Bacterial Glycerol Stock
desmocollin 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004949.2-1848s1c1
Sequence:CCGGCCTGAGTGTAACCCTCCAATACTCGAGTATTGGAGGGTTACACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004949.2-2150s1c1
Sequence:CCGGCGTGAATGATAACAGCCCATTCTCGAGAATGGGCTGTTATCATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004949.2-2640s1c1
Sequence:CCGGGCCCAGCAGAACCTAATTGTACTCGAGTACAATTAGGTTCTGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004949.2-785s1c1
Sequence:CCGGGCATCAAACAAAGGTCCTAAACTCGAGTTTAGGACCTTTGTTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004949.2-2374s1c1
Sequence:CCGGGCTCATATGTAGTACCTATAACTCGAGTTATAGGTACTACATATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004949.3-989s21c1
Sequence:CCGGGACCAAGAACCTCGGAATTTACTCGAGTAAATTCCGAGGTTCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004949.3-1916s21c1
Sequence:CCGGACAACAAGCAATGGATATAAACTCGAGTTTATATCCATTGCTTGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004949.3-1960s21c1
Sequence:CCGGTAGCAGTGGCATAAGGTATAACTCGAGTTATACCTTATGCCACTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004949
DSC2 MISSION shRNA shRNA Plasmid DNA
desmocollin 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004949.2-1848s1c1
Sequence:CCGGCCTGAGTGTAACCCTCCAATACTCGAGTATTGGAGGGTTACACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004949.2-2150s1c1
Sequence:CCGGCGTGAATGATAACAGCCCATTCTCGAGAATGGGCTGTTATCATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004949.2-2640s1c1
Sequence:CCGGGCCCAGCAGAACCTAATTGTACTCGAGTACAATTAGGTTCTGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004949.2-785s1c1
Sequence:CCGGGCATCAAACAAAGGTCCTAAACTCGAGTTTAGGACCTTTGTTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004949.2-2374s1c1
Sequence:CCGGGCTCATATGTAGTACCTATAACTCGAGTTATAGGTACTACATATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004949.3-989s21c1
Sequence:CCGGGACCAAGAACCTCGGAATTTACTCGAGTAAATTCCGAGGTTCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004949.3-1916s21c1
Sequence:CCGGACAACAAGCAATGGATATAAACTCGAGTTTATATCCATTGCTTGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004949.3-1960s21c1
Sequence:CCGGTAGCAGTGGCATAAGGTATAACTCGAGTTATACCTTATGCCACTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004949
DSC2 MISSION shRNA Lentiviral Transduction Particles
desmocollin 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004949.2-1848s1c1
Sequence:CCGGCCTGAGTGTAACCCTCCAATACTCGAGTATTGGAGGGTTACACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004949.2-2150s1c1
Sequence:CCGGCGTGAATGATAACAGCCCATTCTCGAGAATGGGCTGTTATCATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004949.2-2640s1c1
Sequence:CCGGGCCCAGCAGAACCTAATTGTACTCGAGTACAATTAGGTTCTGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004949.2-785s1c1
Sequence:CCGGGCATCAAACAAAGGTCCTAAACTCGAGTTTAGGACCTTTGTTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004949.2-2374s1c1
Sequence:CCGGGCTCATATGTAGTACCTATAACTCGAGTTATAGGTACTACATATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004949.3-989s21c1
Sequence:CCGGGACCAAGAACCTCGGAATTTACTCGAGTAAATTCCGAGGTTCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004949.3-1916s21c1
Sequence:CCGGACAACAAGCAATGGATATAAACTCGAGTTTATATCCATTGCTTGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004949.3-1960s21c1
Sequence:CCGGTAGCAGTGGCATAAGGTATAACTCGAGTTATACCTTATGCCACTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks