EMAIL THIS PAGE TO A FRIEND

DSC3

desmocollin 3

263 Gene Product Result for
Synonyms: CDHF3 DSC DSC1 DSC2 DSC4 HT-CP
UniProtKB ID: Q14574, A6NN35, Q14200, Q9HAZ9
Gene ID:
Human(1825) Summary: The protein encoded by this gene is a calcium-dependent glycoprotein that is a member of the desmocollin subfamily of the cadherin superfamily. These desmosomal family members, along with the desmogleins, are found primarily in epithelial cells where they constitute the adhesive proteins of the desmosome cell-cell junction and are required for cell adhesion and desmosome formation. The desmosomal family members are arranged in two clusters on chromosome 18, occupying less than 650 kb combined. Alternative splicing results in two transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(13507) desmocollin 3
Rat(307563) desmocollin 3
dog(100685374) desmocollin 2
domestic cat(101084909) desmocollin 3
cow(281129) desmocollin 3
sheep(101116442) desmocollin 3
Gene Class: Cell_Adhesion
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001941 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001941 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001941 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007882 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007882 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007882 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU085451 MISSION® esiRNA esiRNA human DSC3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001941 Rosetta Predictions human pricing
NM_024423 Rosetta Predictions human pricing
NM_001107402 Rosetta Predictions rat pricing
NM_007882 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001941 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192244 predicted 435
2 SASI_Hs02_00332848 predicted 1991
3 SASI_Hs02_00332849 predicted 1278
4 SASI_Hs01_00192246 predicted 2302
5 SASI_Hs01_00192249 predicted 561
6 SASI_Hs01_00192250 predicted 2200
7 SASI_Hs01_00192251 predicted 1092
8 SASI_Hs01_00192252 predicted 2848
9 SASI_Hs01_00192253 predicted 1614
10 SASI_Hs02_00332850 predicted 2037
11 SASI_Hs01_00192245 predicted 591
12 SASI_Hs01_00192247 predicted 1602
13 SASI_Hs01_00192248 predicted 2158
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024423 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101787 predicted 436
2 SASI_Hs02_00356742 predicted 1992
3 SASI_Hs01_00101788 predicted 679
4 SASI_Hs02_00356743 predicted 1276
5 SASI_Hs01_00101789 predicted 2300
6 SASI_Hs01_00101792 predicted 565
7 SASI_Hs01_00101793 predicted 2195
8 SASI_Hs01_00101794 predicted 1091
9 SASI_Hs01_00101795 predicted 1617
10 SASI_Hs01_00101796 predicted 2034
11 SASI_Hs01_00101790 predicted 1607
12 SASI_Hs01_00101791 predicted 2152
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107402 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228465 predicted 1492
2 SASI_Rn02_00228466 predicted 1692
3 SASI_Rn02_00228467 predicted 1803
4 SASI_Rn02_00228468 predicted 1852
5 SASI_Rn02_00228469 predicted 2058
6 SASI_Rn02_00228470 predicted 1723
7 SASI_Rn02_00228471 predicted 2182
8 SASI_Rn02_00228472 predicted 1195
9 SASI_Rn02_00228473 predicted 1356
10 SASI_Rn02_00228474 predicted 1839
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007882 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312667 predicted 2343
2 SASI_Mm01_00030717 predicted 2043
3 SASI_Mm01_00030718 predicted 1595
4 SASI_Mm01_00030719 predicted 1825
5 SASI_Mm01_00030720 predicted 659
6 SASI_Mm01_00030721 predicted 1617
7 SASI_Mm01_00030722 predicted 1712
8 SASI_Mm01_00030723 predicted 2170
9 SASI_Mm01_00030724 predicted 1170
10 SASI_Mm02_00312668 predicted 2953
11 SASI_Mm01_00030725 predicted 2315
12 SASI_Mm01_00030726 predicted 1673
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001941
DSC3 MISSION shRNA Bacterial Glycerol Stock
desmocollin 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001941.3-2197s21c1
Sequence:CCGGCAAGGAGTACAGGAGTAATACCTCGAGGTATTACTCCTGTACTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001941.3-1578s21c1
Sequence:CCGGGCCCAATATGTGCGGATTAAACTCGAGTTTAATCCGCACATATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001941.3-1616s21c1
Sequence:CCGGGTCAAAGATCAACGGCTATAACTCGAGTTATAGCCGTTGATCTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001941.2-1899s1c1
Sequence:CCGGGCCCAATACTTCTCCAGAAATCTCGAGATTTCTGGAGAAGTATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001941.2-1165s1c1
Sequence:CCGGGCATTCAATGTGGAAATCTTACTCGAGTAAGATTTCCACATTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001941.2-484s1c1
Sequence:CCGGCCTTGCTCTATGCAAGAGAATCTCGAGATTCTCTTGCATAGAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001941.2-896s1c1
Sequence:CCGGCGCGCCTGAAATACAGCATTTCTCGAGAAATGCTGTATTTCAGGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001941.2-2597s1c1
Sequence:CCGGCCCAAGATTATGTCCTCACTTCTCGAGAAGTGAGGACATAATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001941
DSC3 MISSION shRNA shRNA Plasmid DNA
desmocollin 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001941.3-2197s21c1
Sequence:CCGGCAAGGAGTACAGGAGTAATACCTCGAGGTATTACTCCTGTACTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001941.3-1578s21c1
Sequence:CCGGGCCCAATATGTGCGGATTAAACTCGAGTTTAATCCGCACATATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001941.3-1616s21c1
Sequence:CCGGGTCAAAGATCAACGGCTATAACTCGAGTTATAGCCGTTGATCTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001941.2-1899s1c1
Sequence:CCGGGCCCAATACTTCTCCAGAAATCTCGAGATTTCTGGAGAAGTATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001941.2-1165s1c1
Sequence:CCGGGCATTCAATGTGGAAATCTTACTCGAGTAAGATTTCCACATTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001941.2-484s1c1
Sequence:CCGGCCTTGCTCTATGCAAGAGAATCTCGAGATTCTCTTGCATAGAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001941.2-896s1c1
Sequence:CCGGCGCGCCTGAAATACAGCATTTCTCGAGAAATGCTGTATTTCAGGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001941.2-2597s1c1
Sequence:CCGGCCCAAGATTATGTCCTCACTTCTCGAGAAGTGAGGACATAATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001941
DSC3 MISSION shRNA Lentiviral Transduction Particles
desmocollin 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001941.3-2197s21c1
Sequence:CCGGCAAGGAGTACAGGAGTAATACCTCGAGGTATTACTCCTGTACTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001941.3-1578s21c1
Sequence:CCGGGCCCAATATGTGCGGATTAAACTCGAGTTTAATCCGCACATATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001941.3-1616s21c1
Sequence:CCGGGTCAAAGATCAACGGCTATAACTCGAGTTATAGCCGTTGATCTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001941.2-1899s1c1
Sequence:CCGGGCCCAATACTTCTCCAGAAATCTCGAGATTTCTGGAGAAGTATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001941.2-1165s1c1
Sequence:CCGGGCATTCAATGTGGAAATCTTACTCGAGTAAGATTTCCACATTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001941.2-484s1c1
Sequence:CCGGCCTTGCTCTATGCAAGAGAATCTCGAGATTCTCTTGCATAGAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001941.2-896s1c1
Sequence:CCGGCGCGCCTGAAATACAGCATTTCTCGAGAAATGCTGTATTTCAGGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001941.2-2597s1c1
Sequence:CCGGCCCAAGATTATGTCCTCACTTCTCGAGAAGTGAGGACATAATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007882
DSC3 MISSION shRNA Bacterial Glycerol Stock
desmocollin 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007882.2-1400s1c1
Sequence:CCGGCCAGTGACAAATGAAGGTGTTCTCGAGAACACCTTCATTTGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007882.2-2042s1c1
Sequence:CCGGTGGACCATCAACCAAGTTAATCTCGAGATTAACTTGGTTGATGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007882.2-2289s1c1
Sequence:CCGGCGGTACTGCTAACTTTGGTATCTCGAGATACCAAAGTTAGCAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007882.2-1117s1c1
Sequence:CCGGCGTGGACAAGTACAAACTGATCTCGAGATCAGTTTGTACTTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007882.2-2453s1c1
Sequence:CCGGCCAAGGCTTCTGTGGTACAATCTCGAGATTGTACCACAGAAGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007882
DSC3 MISSION shRNA shRNA Plasmid DNA
desmocollin 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007882.2-1400s1c1
Sequence:CCGGCCAGTGACAAATGAAGGTGTTCTCGAGAACACCTTCATTTGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007882.2-2042s1c1
Sequence:CCGGTGGACCATCAACCAAGTTAATCTCGAGATTAACTTGGTTGATGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007882.2-2289s1c1
Sequence:CCGGCGGTACTGCTAACTTTGGTATCTCGAGATACCAAAGTTAGCAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007882.2-1117s1c1
Sequence:CCGGCGTGGACAAGTACAAACTGATCTCGAGATCAGTTTGTACTTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007882.2-2453s1c1
Sequence:CCGGCCAAGGCTTCTGTGGTACAATCTCGAGATTGTACCACAGAAGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007882
DSC3 MISSION shRNA Lentiviral Transduction Particles
desmocollin 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007882.2-1400s1c1
Sequence:CCGGCCAGTGACAAATGAAGGTGTTCTCGAGAACACCTTCATTTGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007882.2-2042s1c1
Sequence:CCGGTGGACCATCAACCAAGTTAATCTCGAGATTAACTTGGTTGATGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007882.2-2289s1c1
Sequence:CCGGCGGTACTGCTAACTTTGGTATCTCGAGATACCAAAGTTAGCAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007882.2-1117s1c1
Sequence:CCGGCGTGGACAAGTACAAACTGATCTCGAGATCAGTTTGTACTTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007882.2-2453s1c1
Sequence:CCGGCCAAGGCTTCTGTGGTACAATCTCGAGATTGTACCACAGAAGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks