EMAIL THIS PAGE TO A FRIEND

DSCAM

Down syndrome cell adhesion molecule

185 Gene Product Result for
Synonyms: CHD2-42 CHD2-52
UniProtKB ID: O60469, O60468
Gene ID:
Human(1826) Summary: This gene is a member of the immunoglobulin superfamily of cell adhesion molecules (Ig-CAMs), and is involved in human central and peripheral nervous system development. This gene is a candidate for Down syndrome and congenital heart disease (DSCHD). A gene encoding a similar Ig-CAM protein is located on chromosome 11. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
Mouse(13508) Down syndrome cell adhesion molecule
Rat(171119) Down syndrome cell adhesion molecule
fruit fly(35652) Down syndrome cell adhesion molecule
chicken(418525) Down syndrome cell adhesion molecule
cow(100337016) Down syndrome cell adhesion molecule
dog(487768) Down syndrome cell adhesion molecule
Horse(100058783) Down syndrome cell adhesion molecule
domestic cat(101097269) Down syndrome cell adhesion molecule
naked mole-rat(101720512) Down syndrome cell adhesion molecule
domestic guinea pig(100730702) Down syndrome cell adhesion molecule
sheep(101119439) Down syndrome cell adhesion molecule
Gene Class: Cell_Adhesion
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1423 Human DSCAM ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001389 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001389 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001389 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031174 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031174 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031174 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001389 Rosetta Predictions human pricing
NM_206887 Rosetta Predictions human pricing
NM_133587 Rosetta Predictions rat pricing
XM_579627 Rosetta Predictions rat pricing
NM_031174 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001389 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185028 predicted 4234
2 SASI_Hs02_00331754 predicted 5148
3 SASI_Hs01_00185029 predicted 2002
4 SASI_Hs02_00331755 predicted 5320
5 SASI_Hs02_00331756 predicted 1117
6 SASI_Hs01_00185030 predicted 2728
7 SASI_Hs01_00185031 predicted 5523
8 SASI_Hs01_00185032 predicted 1986
9 SASI_Hs01_00185033 predicted 2788
10 SASI_Hs01_00185034 predicted 3501
11 SASI_Hs01_00185035 predicted 1009
12 SASI_Hs01_00185036 predicted 2035
13 SASI_Hs01_00185037 predicted 1728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206887 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036856 predicted 4242
2 SASI_Hs01_00036857 predicted 2017
3 SASI_Hs01_00036858 predicted 1123
4 SASI_Hs01_00036859 predicted 2741
5 SASI_Hs01_00036860 predicted 1996
6 SASI_Hs01_00036861 predicted 2895
7 SASI_Hs01_00036862 predicted 2794
8 SASI_Hs01_00036863 predicted 3507
9 SASI_Hs01_00036864 predicted 1012
10 SASI_Hs01_00036865 predicted 2030
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133587 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089037 predicted 1357
2 SASI_Rn01_00089038 predicted 6192
3 SASI_Rn01_00089039 predicted 5164
4 SASI_Rn01_00089040 predicted 4485
5 SASI_Rn01_00089041 predicted 748
6 SASI_Rn01_00089042 predicted 6175
7 SASI_Rn02_00267789 predicted 5207
8 SASI_Rn01_00089044 predicted 2754
9 SASI_Rn02_00267790 predicted 978
10 SASI_Rn01_00089045 predicted 2048
11 SASI_Rn01_00089043 predicted 853
12 SASI_Rn01_00089046 predicted 1149
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579627 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00129351 predicted 5239
2 SASI_Rn01_00129352 predicted 3405
3 SASI_Rn01_00129353 predicted 3439
4 SASI_Rn01_00129354 predicted 4217
5 SASI_Rn01_00129355 predicted 3541
6 SASI_Rn01_00129356 predicted 1667
7 SASI_Rn01_00129357 predicted 5230
8 SASI_Rn01_00129358 predicted 1970
9 SASI_Rn01_00129359 predicted 4253
10 SASI_Rn01_00129360 predicted 1810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031174 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154777 predicted 2242
2 SASI_Mm01_00154778 predicted 5149
3 SASI_Mm01_00154779 predicted 731
4 SASI_Mm01_00154781 predicted 5191
5 SASI_Mm01_00154782 predicted 2737
6 SASI_Mm02_00337009 predicted 2662
7 SASI_Mm01_00154783 predicted 2028
8 SASI_Mm01_00154784 predicted 1129
9 SASI_Mm02_00337010 predicted 957
10 SASI_Mm01_00154785 predicted 4834
11 SASI_Mm01_00154780 predicted 2395
12 SASI_Mm01_00154786 predicted 6006
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001389
DSCAM MISSION shRNA Bacterial Glycerol Stock
Down syndrome cell adhesion molecule
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001389.3-2238s1c1
Sequence:CCGGCCGCCTTTCATACAACCCTTTCTCGAGAAAGGGTTGTATGAAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001389.3-4431s1c1
Sequence:CCGGCCCAGTCTAGTAACGATTGATCTCGAGATCAATCGTTACTAGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001389.3-6143s1c1
Sequence:CCGGCCTCATACATTTGCCTCCATACTCGAGTATGGAGGCAAATGTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001389.3-1125s1c1
Sequence:CCGGCCATCCATACTGGATGGGTTTCTCGAGAAACCCATCCAGTATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001389.3-3117s1c1
Sequence:CCGGCCCGAAATTGAGATCAAAGATCTCGAGATCTTTGATCTCAATTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001389
DSCAM MISSION shRNA shRNA Plasmid DNA
Down syndrome cell adhesion molecule
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001389.3-2238s1c1
Sequence:CCGGCCGCCTTTCATACAACCCTTTCTCGAGAAAGGGTTGTATGAAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001389.3-4431s1c1
Sequence:CCGGCCCAGTCTAGTAACGATTGATCTCGAGATCAATCGTTACTAGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001389.3-6143s1c1
Sequence:CCGGCCTCATACATTTGCCTCCATACTCGAGTATGGAGGCAAATGTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001389.3-1125s1c1
Sequence:CCGGCCATCCATACTGGATGGGTTTCTCGAGAAACCCATCCAGTATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001389.3-3117s1c1
Sequence:CCGGCCCGAAATTGAGATCAAAGATCTCGAGATCTTTGATCTCAATTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001389
DSCAM MISSION shRNA Lentiviral Transduction Particles
Down syndrome cell adhesion molecule
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001389.3-2238s1c1
Sequence:CCGGCCGCCTTTCATACAACCCTTTCTCGAGAAAGGGTTGTATGAAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001389.3-4431s1c1
Sequence:CCGGCCCAGTCTAGTAACGATTGATCTCGAGATCAATCGTTACTAGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001389.3-6143s1c1
Sequence:CCGGCCTCATACATTTGCCTCCATACTCGAGTATGGAGGCAAATGTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001389.3-1125s1c1
Sequence:CCGGCCATCCATACTGGATGGGTTTCTCGAGAAACCCATCCAGTATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001389.3-3117s1c1
Sequence:CCGGCCCGAAATTGAGATCAAAGATCTCGAGATCTTTGATCTCAATTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031174
DSCAM MISSION shRNA Bacterial Glycerol Stock
Down syndrome cell adhesion molecule
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031174.2-6672s1c1
Sequence:CCGGGCGCAAAGACTACTCTGCTTTCTCGAGAAAGCAGAGTAGTCTTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031174.2-2379s1c1
Sequence:CCGGCCTCGGAGTAACCATTGACAACTCGAGTTGTCAATGGTTACTCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031174.2-4698s1c1
Sequence:CCGGCCTGCAATACTCCGAGGATAACTCGAGTTATCCTCGGAGTATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031174.2-3478s1c1
Sequence:CCGGGCTCCCAAGAAACACTTACAACTCGAGTTGTAAGTGTTTCTTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031174.2-3121s1c1
Sequence:CCGGCCTCCCGAGATTGAGATCAAACTCGAGTTTGATCTCAATCTCGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031174
DSCAM MISSION shRNA shRNA Plasmid DNA
Down syndrome cell adhesion molecule
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031174.2-6672s1c1
Sequence:CCGGGCGCAAAGACTACTCTGCTTTCTCGAGAAAGCAGAGTAGTCTTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031174.2-2379s1c1
Sequence:CCGGCCTCGGAGTAACCATTGACAACTCGAGTTGTCAATGGTTACTCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031174.2-4698s1c1
Sequence:CCGGCCTGCAATACTCCGAGGATAACTCGAGTTATCCTCGGAGTATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031174.2-3478s1c1
Sequence:CCGGGCTCCCAAGAAACACTTACAACTCGAGTTGTAAGTGTTTCTTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031174.2-3121s1c1
Sequence:CCGGCCTCCCGAGATTGAGATCAAACTCGAGTTTGATCTCAATCTCGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031174
DSCAM MISSION shRNA Lentiviral Transduction Particles
Down syndrome cell adhesion molecule
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031174.2-6672s1c1
Sequence:CCGGGCGCAAAGACTACTCTGCTTTCTCGAGAAAGCAGAGTAGTCTTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031174.2-2379s1c1
Sequence:CCGGCCTCGGAGTAACCATTGACAACTCGAGTTGTCAATGGTTACTCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031174.2-4698s1c1
Sequence:CCGGCCTGCAATACTCCGAGGATAACTCGAGTTATCCTCGGAGTATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031174.2-3478s1c1
Sequence:CCGGGCTCCCAAGAAACACTTACAACTCGAGTTGTAAGTGTTTCTTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031174.2-3121s1c1
Sequence:CCGGCCTCCCGAGATTGAGATCAAACTCGAGTTTGATCTCAATCTCGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks