EMAIL THIS PAGE TO A FRIEND

DSCAML1

Down syndrome cell adhesion molecule like 1

107 Gene Product Result for
UniProtKB ID: Q8TD84, Q76MU9, Q8IZY3, Q8IZY4, Q8WXU7, Q9ULT7
Gene ID:
Mouse(114873) Down syndrome cell adhesion molecule like 1
Rat(315615) Down syndrome cell adhesion molecule-like 1
Zebrafish(100002762) Down syndrome cell adhesion molecule like 1
chicken(428249) Down syndrome cell adhesion molecule like 1
dog(489388) Down syndrome cell adhesion molecule like 1
domestic cat(101082341) Down syndrome cell adhesion molecule like 1
cow(538739) Down syndrome cell adhesion molecule like 1
Horse(100071142) Down syndrome cell adhesion molecule like 1
sheep(101113097) Down syndrome cell adhesion molecule like 1
Domestic Rabbit(100342173) Down syndrome cell adhesion molecule like 1
domestic guinea pig(100730554) Down syndrome cell adhesion molecule like 1
naked mole-rat(101703179) Down syndrome cell adhesion molecule like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020693 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020693 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020693 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081270 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081270 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081270 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU180771 MISSION® esiRNA esiRNA targeting mouse Dscaml1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020693 Rosetta Predictions human pricing
NM_001108141 Rosetta Predictions rat pricing
NM_001081270 Rosetta Predictions mouse pricing
XM_620746 Rosetta Predictions mouse pricing
XM_901581 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020693 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353689 predicted 1291
2 SASI_Hs01_00247221 predicted 5654
3 SASI_Hs01_00247222 predicted 1741
4 SASI_Hs01_00247224 predicted 5249
5 SASI_Hs01_00247225 predicted 1653
6 SASI_Hs01_00247226 predicted 2576
7 SASI_Hs02_00353690 predicted 5693
8 SASI_Hs01_00247227 predicted 3346
9 SASI_Hs01_00247228 predicted 1637
10 SASI_Hs01_00247229 predicted 4094
11 SASI_Hs01_00247223 predicted 4918
12 SASI_Hs01_00247230 predicted 4704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108141 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235764 predicted 311
2 SASI_Rn02_00235765 predicted 2991
3 SASI_Rn02_00235766 predicted 1037
4 SASI_Rn02_00235767 predicted 5101
5 SASI_Rn02_00235768 predicted 1692
6 SASI_Rn02_00235769 predicted 4107
7 SASI_Rn02_00235770 predicted 3605
8 SASI_Rn02_00235771 predicted 3275
9 SASI_Rn02_00235772 predicted 1924
10 SASI_Rn02_00235773 predicted 3672
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081270 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296827 predicted 502
2 SASI_Mm02_00296828 predicted 5246
3 SASI_Mm02_00296829 predicted 3008
4 SASI_Mm02_00296830 predicted 988
5 SASI_Mm02_00296831 predicted 5059
6 SASI_Mm02_00296832 predicted 1961
7 SASI_Mm02_00296833 predicted 1837
8 SASI_Mm02_00296834 predicted 1652
9 SASI_Mm02_00296835 predicted 3511
10 SASI_Mm02_00296836 predicted 4191
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_620746 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00214620 predicted 498
2 SASI_Mm01_00214621 predicted 5248
3 SASI_Mm01_00214622 predicted 3012
4 SASI_Mm01_00214623 predicted 994
5 SASI_Mm01_00214624 predicted 5070
6 SASI_Mm01_00214625 predicted 1968
7 SASI_Mm01_00214626 predicted 1849
8 SASI_Mm01_00214627 predicted 1659
9 SASI_Mm01_00214628 predicted 3519
10 SASI_Mm01_00214629 predicted 4194
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901581 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00266524 predicted 1133
2 SASI_Mm01_00266525 predicted 613
3 SASI_Mm01_00266526 predicted 1030
4 SASI_Mm01_00266527 predicted 1058
5 SASI_Mm01_00266528 predicted 1473
6 SASI_Mm01_00266529 predicted 1092
7 SASI_Mm01_00266530 predicted 1072
8 SASI_Mm01_00266531 predicted 1203
9 SASI_Mm01_00266532 predicted 1304
10 SASI_Mm01_00266533 predicted 1044
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020693
DSCAML1 MISSION shRNA Bacterial Glycerol Stock
Down syndrome cell adhesion molecule like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020693.2-6485s1c1
Sequence:CCGGCGCCTGTACATAGAACTCTTTCTCGAGAAAGAGTTCTATGTACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020693.2-2942s1c1
Sequence:CCGGCGACATTGAATACAAGAACAACTCGAGTTGTTCTTGTATTCAATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020693.2-627s1c1
Sequence:CCGGCCCTCTTCAGTGCAGGAATATCTCGAGATATTCCTGCACTGAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020693.2-3062s1c1
Sequence:CCGGCCGCATGTACTCTTTCAACAACTCGAGTTGTTGAAAGAGTACATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020693.2-1662s1c2
Sequence:CCGGGCTGAATATCAGGCGCGAATACTCGAGTATTCGCGCCTGATATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020693
DSCAML1 MISSION shRNA shRNA Plasmid DNA
Down syndrome cell adhesion molecule like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020693.2-6485s1c1
Sequence:CCGGCGCCTGTACATAGAACTCTTTCTCGAGAAAGAGTTCTATGTACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020693.2-2942s1c1
Sequence:CCGGCGACATTGAATACAAGAACAACTCGAGTTGTTCTTGTATTCAATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020693.2-627s1c1
Sequence:CCGGCCCTCTTCAGTGCAGGAATATCTCGAGATATTCCTGCACTGAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020693.2-3062s1c1
Sequence:CCGGCCGCATGTACTCTTTCAACAACTCGAGTTGTTGAAAGAGTACATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020693.2-1662s1c2
Sequence:CCGGGCTGAATATCAGGCGCGAATACTCGAGTATTCGCGCCTGATATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020693
DSCAML1 MISSION shRNA Lentiviral Transduction Particles
Down syndrome cell adhesion molecule like 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020693.2-6485s1c1
Sequence:CCGGCGCCTGTACATAGAACTCTTTCTCGAGAAAGAGTTCTATGTACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020693.2-2942s1c1
Sequence:CCGGCGACATTGAATACAAGAACAACTCGAGTTGTTCTTGTATTCAATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020693.2-627s1c1
Sequence:CCGGCCCTCTTCAGTGCAGGAATATCTCGAGATATTCCTGCACTGAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020693.2-3062s1c1
Sequence:CCGGCCGCATGTACTCTTTCAACAACTCGAGTTGTTGAAAGAGTACATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020693.2-1662s1c2
Sequence:CCGGGCTGAATATCAGGCGCGAATACTCGAGTATTCGCGCCTGATATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081270
DSCAML1 MISSION shRNA Bacterial Glycerol Stock
Down syndrome cell adhesion molecule like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081270.1-460s21c1
Sequence:CCGGATCCACGACAATGACTATTTCCTCGAGGAAATAGTCATTGTCGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081270.1-6330s21c1
Sequence:CCGGGGTGTAGGATGGCCGACAAATCTCGAGATTTGTCGGCCATCCTACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081270.1-1656s21c1
Sequence:CCGGTGAATATCAGGCGCGAATAAACTCGAGTTTATTCGCGCCTGATATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081270.1-4239s21c1
Sequence:CCGGTGAAGACTCCGGCTATTATACCTCGAGGTATAATAGCCGGAGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081270.1-6578s21c1
Sequence:CCGGACACGCGTGGAGAGATATATACTCGAGTATATATCTCTCCACGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081270
DSCAML1 MISSION shRNA shRNA Plasmid DNA
Down syndrome cell adhesion molecule like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081270.1-460s21c1
Sequence:CCGGATCCACGACAATGACTATTTCCTCGAGGAAATAGTCATTGTCGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081270.1-6330s21c1
Sequence:CCGGGGTGTAGGATGGCCGACAAATCTCGAGATTTGTCGGCCATCCTACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081270.1-1656s21c1
Sequence:CCGGTGAATATCAGGCGCGAATAAACTCGAGTTTATTCGCGCCTGATATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081270.1-4239s21c1
Sequence:CCGGTGAAGACTCCGGCTATTATACCTCGAGGTATAATAGCCGGAGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081270.1-6578s21c1
Sequence:CCGGACACGCGTGGAGAGATATATACTCGAGTATATATCTCTCCACGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081270
DSCAML1 MISSION shRNA Lentiviral Transduction Particles
Down syndrome cell adhesion molecule like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081270.1-460s21c1
Sequence:CCGGATCCACGACAATGACTATTTCCTCGAGGAAATAGTCATTGTCGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081270.1-6330s21c1
Sequence:CCGGGGTGTAGGATGGCCGACAAATCTCGAGATTTGTCGGCCATCCTACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081270.1-1656s21c1
Sequence:CCGGTGAATATCAGGCGCGAATAAACTCGAGTTTATTCGCGCCTGATATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081270.1-4239s21c1
Sequence:CCGGTGAAGACTCCGGCTATTATACCTCGAGGTATAATAGCCGGAGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081270.1-6578s21c1
Sequence:CCGGACACGCGTGGAGAGATATATACTCGAGTATATATCTCTCCACGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks