EMAIL THIS PAGE TO A FRIEND

DSCC1

DNA replication and sister chromatid cohesion 1

59 Gene Product Result for
Synonyms: DCC1
UniProtKB ID: Q9BVC3, Q969N5
Gene ID:
Human(79075) Summary: CHTF18 (MIM 613201), CHTF8 (MIM 613202), and DSCC1 are components of an alternative replication factor C (RFC) (see MIM 600404) complex that loads PCNA (MIM 176740) onto DNA during S phase of the cell cycle (Merkle et al., 2003 [PubMed 12766176]
Mouse(72107) defective in sister chromatid cohesion 1 homolog (S. cerevisiae)
Rat(299933) DNA replication and sister chromatid cohesion 1
sheep(101116411) defective in sister chromatid cohesion 1 homolog (S. cerevisiae)
naked mole-rat(101713588) DNA replication and sister chromatid cohesion 1
domestic guinea pig(100730981) DNA replication and sister chromatid cohesion 1
Zebrafish(447872) defective in sister chromatid cohesion 1 homolog (S. cerevisiae)
cow(509563) defective in sister chromatid cohesion 1 homolog (S. cerevisiae)
Horse(100066222) defective in sister chromatid cohesion 1 homolog (S. cerevisiae)
domestic cat(101098435) defective in sister chromatid cohesion 1 homolog (S. cerevisiae)
dog(609036) defective in sister chromatid cohesion 1 homolog (S. cerevisiae)
chicken(420358) defective in sister chromatid cohesion 1 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183089 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183089 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183089 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024094 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024094 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024094 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024094 Rosetta Predictions human pricing
XM_216934 Rosetta Predictions rat pricing
XR_008375 Rosetta Predictions rat pricing
NM_183089 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024094 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099842 predicted 864
2 SASI_Hs01_00099843 predicted 354
3 SASI_Hs01_00099844 predicted 953
4 SASI_Hs01_00099845 predicted 1157
5 SASI_Hs01_00099846 predicted 1095
6 SASI_Hs01_00099847 predicted 715
7 SASI_Hs01_00099848 predicted 1390
8 SASI_Hs01_00099849 predicted 650
9 SASI_Hs01_00099850 predicted 1010
10 SASI_Hs01_00099851 predicted 1270
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216934 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376917 predicted 326
2 SASI_Rn02_00376918 predicted 644
3 SASI_Rn02_00376919 predicted 571
4 SASI_Rn02_00376920 predicted 264
5 SASI_Rn02_00376921 predicted 404
6 SASI_Rn02_00376922 predicted 575
7 SASI_Rn02_00376923 predicted 412
8 SASI_Rn02_00376924 predicted 299
9 SASI_Rn02_00376925 predicted 547
10 SASI_Rn02_00376926 predicted 685
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008375 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00129040 predicted 1093
2 SASI_Rn01_00129041 predicted 1030
3 SASI_Rn01_00129042 predicted 1098
4 SASI_Rn01_00129043 predicted 989
5 SASI_Rn01_00129044 predicted 985
6 SASI_Rn02_00416874 predicted 1136
7 SASI_Rn02_00416875 predicted 1133
8 SASI_Rn01_00129046 predicted 1009
9 SASI_Rn01_00129047 predicted 1077
10 SASI_Rn01_00129049 predicted 1061
11 SASI_Rn01_00129045 predicted 928
12 SASI_Rn01_00129048 predicted 940
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183089 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110987 predicted 803
2 SASI_Mm02_00350078 predicted 897
3 SASI_Mm01_00110988 predicted 558
4 SASI_Mm01_00110989 predicted 989
5 SASI_Mm01_00110990 predicted 603
6 SASI_Mm01_00110991 predicted 558
7 SASI_Mm01_00110992 predicted 600
8 SASI_Mm01_00110993 predicted 973
9 SASI_Mm01_00110994 predicted 425
10 SASI_Mm01_00110995 predicted 907
11 SASI_Mm01_00110996 predicted 1094
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183089
VALIDATED
DSCC1 MISSION shRNA Bacterial Glycerol Stock
DNA replication and sister chromatid cohesion 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183089.2-612s21c1
Sequence:CCGGGCTCAGTTACAAGTCCTAAATCTCGAGATTTAGGACTTGTAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183089.2-1020s21c1
Sequence:CCGGTCAAGACCAGAAATCATATTTCTCGAGAAATATGATTTCTGGTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183089.2-1121s21c1
Sequence:CCGGGGAAGACATCACTCCATATATCTCGAGATATATGGAGTGATGTCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183089.2-422s21c1
Sequence:CCGGGATCTTTGGCTTCTCTAATAACTCGAGTTATTAGAGAAGCCAAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183089.2-981s1c1
Sequence:CCGGCTTGATCAGCTCAAGGGTTTACTCGAGTAAACCCTTGAGCTGATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183089.2-1152s21c1
Sequence:CCGGTGCGGAGAGAAGCAAACTATACTCGAGTATAGTTTGCTTCTCTCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183089.1-690s1c1
Sequence:CCGGCTGAACCATGTGACTCAGCTTCTCGAGAAGCTGAGTCACATGGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183089.1-909s1c1
Sequence:CCGGGCCGTGAAGTTTAATCTTGCACTCGAGTGCAAGATTAAACTTCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183089.1-678s1c1
Sequence:CCGGGAGATCAAACTTCTGAACCATCTCGAGATGGTTCAGAAGTTTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183089
VALIDATED
DSCC1 MISSION shRNA shRNA Plasmid DNA
DNA replication and sister chromatid cohesion 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183089.2-612s21c1
Sequence:CCGGGCTCAGTTACAAGTCCTAAATCTCGAGATTTAGGACTTGTAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183089.2-1020s21c1
Sequence:CCGGTCAAGACCAGAAATCATATTTCTCGAGAAATATGATTTCTGGTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183089.2-1121s21c1
Sequence:CCGGGGAAGACATCACTCCATATATCTCGAGATATATGGAGTGATGTCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183089.2-422s21c1
Sequence:CCGGGATCTTTGGCTTCTCTAATAACTCGAGTTATTAGAGAAGCCAAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183089.2-981s1c1
Sequence:CCGGCTTGATCAGCTCAAGGGTTTACTCGAGTAAACCCTTGAGCTGATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183089.2-1152s21c1
Sequence:CCGGTGCGGAGAGAAGCAAACTATACTCGAGTATAGTTTGCTTCTCTCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183089.1-690s1c1
Sequence:CCGGCTGAACCATGTGACTCAGCTTCTCGAGAAGCTGAGTCACATGGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183089.1-909s1c1
Sequence:CCGGGCCGTGAAGTTTAATCTTGCACTCGAGTGCAAGATTAAACTTCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183089.1-678s1c1
Sequence:CCGGGAGATCAAACTTCTGAACCATCTCGAGATGGTTCAGAAGTTTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183089
VALIDATED
DSCC1 MISSION shRNA Lentiviral Transduction Particles
DNA replication and sister chromatid cohesion 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183089.2-612s21c1
Sequence:CCGGGCTCAGTTACAAGTCCTAAATCTCGAGATTTAGGACTTGTAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183089.2-1020s21c1
Sequence:CCGGTCAAGACCAGAAATCATATTTCTCGAGAAATATGATTTCTGGTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183089.2-1121s21c1
Sequence:CCGGGGAAGACATCACTCCATATATCTCGAGATATATGGAGTGATGTCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183089.2-422s21c1
Sequence:CCGGGATCTTTGGCTTCTCTAATAACTCGAGTTATTAGAGAAGCCAAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183089.2-981s1c1
Sequence:CCGGCTTGATCAGCTCAAGGGTTTACTCGAGTAAACCCTTGAGCTGATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183089.2-1152s21c1
Sequence:CCGGTGCGGAGAGAAGCAAACTATACTCGAGTATAGTTTGCTTCTCTCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183089.1-690s1c1
Sequence:CCGGCTGAACCATGTGACTCAGCTTCTCGAGAAGCTGAGTCACATGGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183089.1-909s1c1
Sequence:CCGGGCCGTGAAGTTTAATCTTGCACTCGAGTGCAAGATTAAACTTCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183089.1-678s1c1
Sequence:CCGGGAGATCAAACTTCTGAACCATCTCGAGATGGTTCAGAAGTTTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024094
VALIDATED
DSCC1 MISSION shRNA Bacterial Glycerol Stock
DNA replication and sister chromatid cohesion 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024094.1-957s1c1
Sequence:CCGGGAAATTCAATCTCGCTGAGTTCTCGAGAACTCAGCGAGATTGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024094.1-1093s1c1
Sequence:CCGGGTAGATGATTTACCTGAGGATCTCGAGATCCTCAGGTAAATCATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_024094.1-1162s1c1
Sequence:CCGGGAAGAAGATATTGCTCCATATCTCGAGATATGGAGCAATATCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_024094.1-429s1c1
Sequence:CCGGGAAGGAAGATTCACACTGTAACTCGAGTTACAGTGTGAATCTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024094.1-1794s1c1
Sequence:CCGGCCATGAAATTGGCTGAATAATCTCGAGATTATTCAGCCAATTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024094.1-784s1c1
Sequence:CCGGGTTCCTTTGAACACATGCCTTCTCGAGAAGGCATGTGTTCAAAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024094.1-676s1c1
Sequence:CCGGGCCTGTAAGATTGGAGGTTATCTCGAGATAACCTCCAATCTTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024094.1-1106s1c1
Sequence:CCGGCTGAGGATAATCAGGAACGTTCTCGAGAACGTTCCTGATTATCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024094.1-296s1c1
Sequence:CCGGGTCTTGTGATTCGTGGTGATACTCGAGTATCACCACGAATCACAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024094.1-1206s1c1
Sequence:CCGGGCAAACCATAGGTGCATTACTCTCGAGAGTAATGCACCTATGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_024094.1-500s1c1
Sequence:CCGGGAAGACGTAGACCCAAGTTAACTCGAGTTAACTTGGGTCTACGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024094
VALIDATED
DSCC1 MISSION shRNA shRNA Plasmid DNA
DNA replication and sister chromatid cohesion 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024094.1-957s1c1
Sequence:CCGGGAAATTCAATCTCGCTGAGTTCTCGAGAACTCAGCGAGATTGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024094.1-1093s1c1
Sequence:CCGGGTAGATGATTTACCTGAGGATCTCGAGATCCTCAGGTAAATCATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_024094.1-1162s1c1
Sequence:CCGGGAAGAAGATATTGCTCCATATCTCGAGATATGGAGCAATATCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_024094.1-429s1c1
Sequence:CCGGGAAGGAAGATTCACACTGTAACTCGAGTTACAGTGTGAATCTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024094.1-1794s1c1
Sequence:CCGGCCATGAAATTGGCTGAATAATCTCGAGATTATTCAGCCAATTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024094.1-784s1c1
Sequence:CCGGGTTCCTTTGAACACATGCCTTCTCGAGAAGGCATGTGTTCAAAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024094.1-676s1c1
Sequence:CCGGGCCTGTAAGATTGGAGGTTATCTCGAGATAACCTCCAATCTTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024094.1-1106s1c1
Sequence:CCGGCTGAGGATAATCAGGAACGTTCTCGAGAACGTTCCTGATTATCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024094.1-296s1c1
Sequence:CCGGGTCTTGTGATTCGTGGTGATACTCGAGTATCACCACGAATCACAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024094.1-1206s1c1
Sequence:CCGGGCAAACCATAGGTGCATTACTCTCGAGAGTAATGCACCTATGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_024094.1-500s1c1
Sequence:CCGGGAAGACGTAGACCCAAGTTAACTCGAGTTAACTTGGGTCTACGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024094
VALIDATED
DSCC1 MISSION shRNA Lentiviral Transduction Particles
DNA replication and sister chromatid cohesion 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024094.1-957s1c1
Sequence:CCGGGAAATTCAATCTCGCTGAGTTCTCGAGAACTCAGCGAGATTGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024094.1-1093s1c1
Sequence:CCGGGTAGATGATTTACCTGAGGATCTCGAGATCCTCAGGTAAATCATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_024094.1-1162s1c1
Sequence:CCGGGAAGAAGATATTGCTCCATATCTCGAGATATGGAGCAATATCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_024094.1-429s1c1
Sequence:CCGGGAAGGAAGATTCACACTGTAACTCGAGTTACAGTGTGAATCTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024094.1-1794s1c1
Sequence:CCGGCCATGAAATTGGCTGAATAATCTCGAGATTATTCAGCCAATTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024094.1-784s1c1
Sequence:CCGGGTTCCTTTGAACACATGCCTTCTCGAGAAGGCATGTGTTCAAAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024094.1-676s1c1
Sequence:CCGGGCCTGTAAGATTGGAGGTTATCTCGAGATAACCTCCAATCTTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024094.1-1106s1c1
Sequence:CCGGCTGAGGATAATCAGGAACGTTCTCGAGAACGTTCCTGATTATCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024094.1-296s1c1
Sequence:CCGGGTCTTGTGATTCGTGGTGATACTCGAGTATCACCACGAATCACAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024094.1-1206s1c1
Sequence:CCGGGCAAACCATAGGTGCATTACTCTCGAGAGTAATGCACCTATGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_024094.1-500s1c1
Sequence:CCGGGAAGACGTAGACCCAAGTTAACTCGAGTTAACTTGGGTCTACGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks