EMAIL THIS PAGE TO A FRIEND

DSCR10

Down syndrome critical region gene 10 (non-protein coding)

15 Gene Product Result for
Species: Human DSCR10(259234)
UniProtKB ID: P59022, Q52LN2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302767 ANTI-DSCR10 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_148676 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_148676 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_148676 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_148676 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148676 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020781 predicted 499
2 SASI_Hs01_00020782 predicted 429
3 SASI_Hs01_00020783 predicted 515
4 SASI_Hs01_00020784 predicted 449
5 SASI_Hs01_00020785 predicted 423
6 SASI_Hs01_00020786 predicted 494
7 SASI_Hs01_00020787 predicted 491
8 SASI_Hs01_00020788 predicted 504
9 SASI_Hs01_00020789 predicted 496
10 SASI_Hs01_00020790 predicted 606
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148676
DSCR10 MISSION shRNA Bacterial Glycerol Stock
Down syndrome critical region gene 10 (non-protein coding)
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000183784    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_148676.1-697s1c1
Sequence:CCGGCTGCTAACATTTGGAAACATTCTCGAGAATGTTTCCAAATGTTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148676.1-547s1c1
Sequence:CCGGGTTCTCTGCTGAGTCTGGTTACTCGAGTAACCAGACTCAGCAGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183281    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_148676.1-696s1c1
Sequence:CCGGGCTGCTAACATTTGGAAACATCTCGAGATGTTTCCAAATGTTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148676
DSCR10 MISSION shRNA shRNA Plasmid DNA
Down syndrome critical region gene 10 (non-protein coding)
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000183784    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_148676.1-697s1c1
Sequence:CCGGCTGCTAACATTTGGAAACATTCTCGAGAATGTTTCCAAATGTTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148676.1-547s1c1
Sequence:CCGGGTTCTCTGCTGAGTCTGGTTACTCGAGTAACCAGACTCAGCAGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183281    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_148676.1-696s1c1
Sequence:CCGGGCTGCTAACATTTGGAAACATCTCGAGATGTTTCCAAATGTTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148676
DSCR10 MISSION shRNA Lentiviral Transduction Particles
Down syndrome critical region gene 10 (non-protein coding)
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000183784    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_148676.1-697s1c1
Sequence:CCGGCTGCTAACATTTGGAAACATTCTCGAGAATGTTTCCAAATGTTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148676.1-547s1c1
Sequence:CCGGGTTCTCTGCTGAGTCTGGTTACTCGAGTAACCAGACTCAGCAGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183281    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_148676.1-696s1c1
Sequence:CCGGGCTGCTAACATTTGGAAACATCTCGAGATGTTTCCAAATGTTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks