EMAIL THIS PAGE TO A FRIEND

DSCR3

Down syndrome critical region gene 3

47 Gene Product Result for
Synonyms: DCRA DSCRA
UniProtKB ID: O14972, B2R6T8, D3DSH4, Q2TAY6
Gene ID:
Human(10311) Summary: The region of chromosome 21 between genes CBR and ERG (CBR-ERG region), which spans 2.5 Mb on 21q22.2, has been defined by analysis of patients with partial trisomy 21. It contributes significantly to the pathogenesis of many characteristics of Down syndrome, including morphological features, hypotonia, and mental retardation. The DSCR3 (Down syndrome critical region gene 3) gene is found in this region and is predictated to contain eight exons. DSCR3 is expressed in most tissues examined. [provided by RefSeq, Jul 2008]
Mouse(13185) Down syndrome critical region gene 3
Rat(360703) Down syndrome critical region gene 3
Zebrafish(445026) Down syndrome critical region gene 3
cow(507647) Down syndrome critical region gene 3
domestic cat(101081072) Down syndrome critical region gene 3
dog(610353) Down syndrome critical region gene 3
chicken(418519) Down syndrome critical region gene 3
domestic guinea pig(100715106) Down syndrome critical region gene 3
naked mole-rat(101721206) Down syndrome critical region gene 3
sheep(101116695) Down syndrome critical region gene 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006052 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006052 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006052 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007834 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007834 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007834 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU123561 MISSION® esiRNA esiRNA human DSCR3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006052 Rosetta Predictions human pricing
NM_001108316 Rosetta Predictions rat pricing
NM_007834 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006052 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202087 predicted 533
2 SASI_Hs01_00202088 predicted 783
3 SASI_Hs01_00202089 predicted 1174
4 SASI_Hs01_00202090 predicted 561
5 SASI_Hs01_00202091 predicted 708
6 SASI_Hs01_00202092 predicted 628
7 SASI_Hs01_00202093 predicted 751
8 SASI_Hs01_00202094 predicted 314
9 SASI_Hs02_00340806 predicted 775
10 SASI_Hs01_00202095 predicted 929
11 SASI_Hs01_00202096 predicted 576
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108316 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237459 predicted 211
2 SASI_Rn02_00237460 predicted 220
3 SASI_Rn02_00237461 predicted 1019
4 SASI_Rn02_00237462 predicted 295
5 SASI_Rn02_00237463 predicted 344
6 SASI_Rn02_00237464 predicted 338
7 SASI_Rn02_00237465 predicted 939
8 SASI_Rn02_00237466 predicted 683
9 SASI_Rn02_00237467 predicted 501
10 SASI_Rn02_00237468 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007834 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097055 predicted 560
2 SASI_Mm01_00097056 predicted 433
3 SASI_Mm01_00097057 predicted 946
4 SASI_Mm01_00097058 predicted 554
5 SASI_Mm01_00097059 predicted 469
6 SASI_Mm01_00097060 predicted 1093
7 SASI_Mm01_00097061 predicted 714
8 SASI_Mm01_00097062 predicted 773
9 SASI_Mm01_00097063 predicted 1161
10 SASI_Mm01_00097064 predicted 898
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006052
VALIDATED
DSCR3 MISSION shRNA Bacterial Glycerol Stock
Down syndrome critical region gene 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006052.1-311s1c1
Sequence:CCGGCGTGGTGGTCATATCGAGTAACTCGAGTTACTCGATATGACCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006052.1-924s1c1
Sequence:CCGGGCCACGGAGATTCAGAACATTCTCGAGAATGTTCTGAATCTCCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006052.1-558s1c1
Sequence:CCGGGAGACGTATCATGGCGTGTTTCTCGAGAAACACGCCATGATACGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006052.1-1035s1c1
Sequence:CCGGACCAACTTCAAAGTGGAATTTCTCGAGAAATTCCACTTTGAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006052.1-723s1c1
Sequence:CCGGGAAACCTTACAGAACGTCAAACTCGAGTTTGACGTTCTGTAAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006052.1-697s21c1
Sequence:CCGGGTCCCGTGGACTTCACGATTACTCGAGTAATCGTGAAGTCCACGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006052.1-1262s21c1
Sequence:CCGGCAGACCCTCAAATTAACTTTCCTCGAGGAAAGTTAATTTGAGGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006052.1-1364s21c1
Sequence:CCGGTGCTATTTGCCAAGACCATTTCTCGAGAAATGGTCTTGGCAAATAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006052.1-624s21c1
Sequence:CCGGTTGGCCAAGGACTTGACAAAGCTCGAGCTTTGTCAAGTCCTTGGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006052
VALIDATED
DSCR3 MISSION shRNA shRNA Plasmid DNA
Down syndrome critical region gene 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006052.1-311s1c1
Sequence:CCGGCGTGGTGGTCATATCGAGTAACTCGAGTTACTCGATATGACCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006052.1-924s1c1
Sequence:CCGGGCCACGGAGATTCAGAACATTCTCGAGAATGTTCTGAATCTCCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006052.1-558s1c1
Sequence:CCGGGAGACGTATCATGGCGTGTTTCTCGAGAAACACGCCATGATACGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006052.1-1035s1c1
Sequence:CCGGACCAACTTCAAAGTGGAATTTCTCGAGAAATTCCACTTTGAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006052.1-723s1c1
Sequence:CCGGGAAACCTTACAGAACGTCAAACTCGAGTTTGACGTTCTGTAAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006052.1-697s21c1
Sequence:CCGGGTCCCGTGGACTTCACGATTACTCGAGTAATCGTGAAGTCCACGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006052.1-1262s21c1
Sequence:CCGGCAGACCCTCAAATTAACTTTCCTCGAGGAAAGTTAATTTGAGGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006052.1-1364s21c1
Sequence:CCGGTGCTATTTGCCAAGACCATTTCTCGAGAAATGGTCTTGGCAAATAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006052.1-624s21c1
Sequence:CCGGTTGGCCAAGGACTTGACAAAGCTCGAGCTTTGTCAAGTCCTTGGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006052
VALIDATED
DSCR3 MISSION shRNA Lentiviral Transduction Particles
Down syndrome critical region gene 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006052.1-311s1c1
Sequence:CCGGCGTGGTGGTCATATCGAGTAACTCGAGTTACTCGATATGACCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006052.1-924s1c1
Sequence:CCGGGCCACGGAGATTCAGAACATTCTCGAGAATGTTCTGAATCTCCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006052.1-558s1c1
Sequence:CCGGGAGACGTATCATGGCGTGTTTCTCGAGAAACACGCCATGATACGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006052.1-1035s1c1
Sequence:CCGGACCAACTTCAAAGTGGAATTTCTCGAGAAATTCCACTTTGAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006052.1-723s1c1
Sequence:CCGGGAAACCTTACAGAACGTCAAACTCGAGTTTGACGTTCTGTAAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006052.1-697s21c1
Sequence:CCGGGTCCCGTGGACTTCACGATTACTCGAGTAATCGTGAAGTCCACGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006052.1-1262s21c1
Sequence:CCGGCAGACCCTCAAATTAACTTTCCTCGAGGAAAGTTAATTTGAGGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006052.1-1364s21c1
Sequence:CCGGTGCTATTTGCCAAGACCATTTCTCGAGAAATGGTCTTGGCAAATAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006052.1-624s21c1
Sequence:CCGGTTGGCCAAGGACTTGACAAAGCTCGAGCTTTGTCAAGTCCTTGGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007834
VALIDATED
DSCR3 MISSION shRNA Bacterial Glycerol Stock
Down syndrome critical region gene 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097835    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007834.1-1333s1c1
Sequence:CCGGGCTCTCTGATTGAGTCTGTAACTCGAGTTACAGACTCAATCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007834.1-380s1c1
Sequence:CCGGCGGCGTGTTTGTCAACATTCACTCGAGTGAATGTTGACAAACACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007834.1-446s1c1
Sequence:CCGGCCTGACCAAGACCTGTGAATTCTCGAGAATTCACAGGTCTTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007834.1-158s1c1
Sequence:CCGGCCAGGGAGTCTCTTTGACAATCTCGAGATTGTCAAAGAGACTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007834.1-257s1c1
Sequence:CCGGCCAGATTATCAACAGCACCATCTCGAGATGGTGCTGTTGATAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007834.3-750s21c1
Sequence:CCGGCACTTCCCAAATTCTTCATTACTCGAGTAATGAAGAATTTGGGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007834.3-1518s21c1
Sequence:CCGGGCTCTCTGATTGAGTCTGTAACTCGAGTTACAGACTCAATCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007834.3-565s21c1
Sequence:CCGGCGGCGTGTTTGTCAACATTCACTCGAGTGAATGTTGACAAACACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007834.3-343s21c1
Sequence:CCGGCCAGGGAGTCTCTTTGACAATCTCGAGATTGTCAAAGAGACTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007834.3-921s21c1
Sequence:CCGGCCACAGAGATTCAGAATATTCCTCGAGGAATATTCTGAATCTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007834
VALIDATED
DSCR3 MISSION shRNA shRNA Plasmid DNA
Down syndrome critical region gene 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097835    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007834.1-1333s1c1
Sequence:CCGGGCTCTCTGATTGAGTCTGTAACTCGAGTTACAGACTCAATCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007834.1-380s1c1
Sequence:CCGGCGGCGTGTTTGTCAACATTCACTCGAGTGAATGTTGACAAACACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007834.1-446s1c1
Sequence:CCGGCCTGACCAAGACCTGTGAATTCTCGAGAATTCACAGGTCTTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007834.1-158s1c1
Sequence:CCGGCCAGGGAGTCTCTTTGACAATCTCGAGATTGTCAAAGAGACTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007834.1-257s1c1
Sequence:CCGGCCAGATTATCAACAGCACCATCTCGAGATGGTGCTGTTGATAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007834.3-750s21c1
Sequence:CCGGCACTTCCCAAATTCTTCATTACTCGAGTAATGAAGAATTTGGGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007834.3-1518s21c1
Sequence:CCGGGCTCTCTGATTGAGTCTGTAACTCGAGTTACAGACTCAATCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007834.3-565s21c1
Sequence:CCGGCGGCGTGTTTGTCAACATTCACTCGAGTGAATGTTGACAAACACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007834.3-343s21c1
Sequence:CCGGCCAGGGAGTCTCTTTGACAATCTCGAGATTGTCAAAGAGACTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007834.3-921s21c1
Sequence:CCGGCCACAGAGATTCAGAATATTCCTCGAGGAATATTCTGAATCTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007834
VALIDATED
DSCR3 MISSION shRNA Lentiviral Transduction Particles
Down syndrome critical region gene 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097835    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007834.1-1333s1c1
Sequence:CCGGGCTCTCTGATTGAGTCTGTAACTCGAGTTACAGACTCAATCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007834.1-380s1c1
Sequence:CCGGCGGCGTGTTTGTCAACATTCACTCGAGTGAATGTTGACAAACACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007834.1-446s1c1
Sequence:CCGGCCTGACCAAGACCTGTGAATTCTCGAGAATTCACAGGTCTTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007834.1-158s1c1
Sequence:CCGGCCAGGGAGTCTCTTTGACAATCTCGAGATTGTCAAAGAGACTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007834.1-257s1c1
Sequence:CCGGCCAGATTATCAACAGCACCATCTCGAGATGGTGCTGTTGATAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007834.3-750s21c1
Sequence:CCGGCACTTCCCAAATTCTTCATTACTCGAGTAATGAAGAATTTGGGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007834.3-1518s21c1
Sequence:CCGGGCTCTCTGATTGAGTCTGTAACTCGAGTTACAGACTCAATCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007834.3-565s21c1
Sequence:CCGGCGGCGTGTTTGTCAACATTCACTCGAGTGAATGTTGACAAACACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007834.3-343s21c1
Sequence:CCGGCCAGGGAGTCTCTTTGACAATCTCGAGATTGTCAAAGAGACTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007834.3-921s21c1
Sequence:CCGGCCACAGAGATTCAGAATATTCCTCGAGGAATATTCTGAATCTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks