EMAIL THIS PAGE TO A FRIEND

DSCR4

Down syndrome critical region gene 4

54 Gene Product Result for
Synonyms: DCRB DSCRB
Species: Human DSCR4(10281)
UniProtKB ID: P56555, Q4VB31
Gene ID:
Human(10281) Summary: The region of chromosome 21 between genes CBR and ERG (CBR-ERG region), which spans 2.5 Mb on 21q22.2, has been defined by analysis of patients with partial trisomy 21. It contributes significantly to the pathogenesis of many characteristics of Down syndrome, including morphological features, hypotonia, and mental retardation. This gene is found in this region and multiple transcripts may exist. It is mainly expressed in the placenta. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005867 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005867 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005867 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU058541 MISSION® esiRNA esiRNA human DSCR4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005867 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005867 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200817 predicted 633
2 SASI_Hs02_00340435 predicted 565
3 SASI_Hs01_00200819 predicted 674
4 SASI_Hs01_00200820 predicted 785
5 SASI_Hs01_00200821 predicted 534
6 SASI_Hs01_00200822 predicted 553
7 SASI_Hs01_00200823 predicted 679
8 SASI_Hs01_00200824 predicted 619
9 SASI_Hs01_00200825 predicted 625
10 SASI_Hs01_00200826 predicted 787
11 SASI_Hs01_00200818 predicted 586
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005867
DSCR4 MISSION shRNA Bacterial Glycerol Stock
Down syndrome critical region gene 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005867.2-438s21c1
Sequence:CCGGGATAAGCGCAAGCCCATCAACCTCGAGGTTGATGGGCTTGCGCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005867.2-763s21c1
Sequence:CCGGGCTGAGTAGGTCCACAAATAACTCGAGTTATTTGTGGACCTACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005867.2-252s21c1
Sequence:CCGGTAAAGTCTGCAACATCGTTTCCTCGAGGAAACGATGTTGCAGACTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005867.2-566s21c1
Sequence:CCGGAGTGGGAAAGAAAGAGCTTTACTCGAGTAAAGCTCTTTCTTTCCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005867.2-250s1c1
Sequence:CCGGCCTAAAGTCTGCAACATCGTTCTCGAGAACGATGTTGCAGACTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005867.2-529s1c1
Sequence:CCGGGTCTGATTCTTGTGTCTACTTCTCGAGAAGTAGACACAAGAATCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005867.2-411s1c1
Sequence:CCGGGAAATCAGATGGGAGAAGGGACTCGAGTCCCTTCTCCCATCTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005867.2-402s1c1
Sequence:CCGGGCTCCACAAGAAATCAGATGGCTCGAGCCATCTGATTTCTTGTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005867.2-406s1c1
Sequence:CCGGCACAAGAAATCAGATGGGAGACTCGAGTCTCCCATCTGATTTCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005867
DSCR4 MISSION shRNA shRNA Plasmid DNA
Down syndrome critical region gene 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005867.2-438s21c1
Sequence:CCGGGATAAGCGCAAGCCCATCAACCTCGAGGTTGATGGGCTTGCGCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005867.2-763s21c1
Sequence:CCGGGCTGAGTAGGTCCACAAATAACTCGAGTTATTTGTGGACCTACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005867.2-252s21c1
Sequence:CCGGTAAAGTCTGCAACATCGTTTCCTCGAGGAAACGATGTTGCAGACTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005867.2-566s21c1
Sequence:CCGGAGTGGGAAAGAAAGAGCTTTACTCGAGTAAAGCTCTTTCTTTCCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005867.2-250s1c1
Sequence:CCGGCCTAAAGTCTGCAACATCGTTCTCGAGAACGATGTTGCAGACTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005867.2-529s1c1
Sequence:CCGGGTCTGATTCTTGTGTCTACTTCTCGAGAAGTAGACACAAGAATCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005867.2-411s1c1
Sequence:CCGGGAAATCAGATGGGAGAAGGGACTCGAGTCCCTTCTCCCATCTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005867.2-402s1c1
Sequence:CCGGGCTCCACAAGAAATCAGATGGCTCGAGCCATCTGATTTCTTGTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005867.2-406s1c1
Sequence:CCGGCACAAGAAATCAGATGGGAGACTCGAGTCTCCCATCTGATTTCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005867
DSCR4 MISSION shRNA Lentiviral Transduction Particles
Down syndrome critical region gene 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005867.2-438s21c1
Sequence:CCGGGATAAGCGCAAGCCCATCAACCTCGAGGTTGATGGGCTTGCGCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005867.2-763s21c1
Sequence:CCGGGCTGAGTAGGTCCACAAATAACTCGAGTTATTTGTGGACCTACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005867.2-252s21c1
Sequence:CCGGTAAAGTCTGCAACATCGTTTCCTCGAGGAAACGATGTTGCAGACTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005867.2-566s21c1
Sequence:CCGGAGTGGGAAAGAAAGAGCTTTACTCGAGTAAAGCTCTTTCTTTCCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005867.2-250s1c1
Sequence:CCGGCCTAAAGTCTGCAACATCGTTCTCGAGAACGATGTTGCAGACTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005867.2-529s1c1
Sequence:CCGGGTCTGATTCTTGTGTCTACTTCTCGAGAAGTAGACACAAGAATCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005867.2-411s1c1
Sequence:CCGGGAAATCAGATGGGAGAAGGGACTCGAGTCCCTTCTCCCATCTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005867.2-402s1c1
Sequence:CCGGGCTCCACAAGAAATCAGATGGCTCGAGCCATCTGATTTCTTGTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005867.2-406s1c1
Sequence:CCGGCACAAGAAATCAGATGGGAGACTCGAGTCTCCCATCTGATTTCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks