EMAIL THIS PAGE TO A FRIEND

DSCR8

Down syndrome critical region gene 8

65 Gene Product Result for
Synonyms: C21orf65 CT25.1a CT25.1b MMA-1 MMA-1a MMA-1b MMA1 MTAG2
Species: Human DSCR8(84677)
UniProtKB ID: Q96T75, Q8N3X0, Q8NDY5, Q96B46
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032589 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032589 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032589 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_203429 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203429 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203429 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU224631 MISSION® esiRNA esiRNA targeting human DSCR8 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032589 Rosetta Predictions human pricing
NM_203428 Rosetta Predictions human pricing
NM_203429 Rosetta Predictions human pricing
XR_040165 Rosetta Predictions human pricing
XR_040166 Rosetta Predictions human pricing
XR_040167 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032589 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099226 predicted 185
2 SASI_Hs01_00099227 predicted 376
3 SASI_Hs01_00099228 predicted 170
4 SASI_Hs01_00099229 predicted 179
5 SASI_Hs01_00099230 predicted 161
6 SASI_Hs01_00099231 predicted 485
7 SASI_Hs01_00099232 predicted 161
8 SASI_Hs01_00099233 predicted 365
9 SASI_Hs01_00099234 predicted 461
10 SASI_Hs01_00099235 predicted 342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203428 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088204 predicted 381
2 SASI_Hs01_00088205 predicted 158
3 SASI_Hs01_00088206 predicted 379
4 SASI_Hs01_00088207 predicted 170
5 SASI_Hs01_00088208 predicted 394
6 SASI_Hs01_00088209 predicted 250
7 SASI_Hs01_00088210 predicted 368
8 SASI_Hs01_00088211 predicted 305
9 SASI_Hs01_00088212 predicted 252
10 SASI_Hs01_00088213 predicted 157
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203429 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015615 predicted 633
2 SASI_Hs01_00015616 predicted 396
3 SASI_Hs01_00015617 predicted 406
4 SASI_Hs01_00015618 predicted 160
5 SASI_Hs01_00015619 predicted 637
6 SASI_Hs01_00015620 predicted 270
7 SASI_Hs01_00015621 predicted 299
8 SASI_Hs01_00015622 predicted 307
9 SASI_Hs01_00015623 predicted 162
10 SASI_Hs01_00015624 predicted 251
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040165 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516508 predicted 145
2 SASI_Hs02_00516509 predicted 338
3 SASI_Hs02_00516510 predicted 127
4 SASI_Hs02_00516511 predicted 146
5 SASI_Hs02_00516512 predicted 130
6 SASI_Hs02_00516513 predicted 441
7 SASI_Hs02_00516514 predicted 127
8 SASI_Hs02_00516515 predicted 377
9 SASI_Hs02_00516516 predicted 329
10 SASI_Hs02_00516517 predicted 418
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040166 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516518 predicted 147
2 SASI_Hs02_00516519 predicted 345
3 SASI_Hs02_00516520 predicted 126
4 SASI_Hs02_00516521 predicted 144
5 SASI_Hs02_00516522 predicted 122
6 SASI_Hs02_00516523 predicted 441
7 SASI_Hs02_00516524 predicted 124
8 SASI_Hs02_00516525 predicted 369
9 SASI_Hs02_00516526 predicted 328
10 SASI_Hs02_00516527 predicted 422
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040167 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516528 predicted 143
2 SASI_Hs02_00516529 predicted 343
3 SASI_Hs02_00516530 predicted 125
4 SASI_Hs02_00516531 predicted 147
5 SASI_Hs02_00516532 predicted 124
6 SASI_Hs02_00516533 predicted 448
7 SASI_Hs02_00516534 predicted 127
8 SASI_Hs02_00516535 predicted 377
9 SASI_Hs02_00516536 predicted 328
10 SASI_Hs02_00516537 predicted 419
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032589
DSCR8 MISSION shRNA Bacterial Glycerol Stock
Down syndrome critical region gene 8
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000122462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032589.2-365s1c1
Sequence:CCGGGCTGTTCATGCCAAGACCGAACTCGAGTTCGGTCTTGGCATGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032589.2-337s1c1
Sequence:CCGGGAAATCAAGAAAGTTCTGGAACTCGAGTTCCAGAACTTTCTTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032589
DSCR8 MISSION shRNA shRNA Plasmid DNA
Down syndrome critical region gene 8
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000122462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032589.2-365s1c1
Sequence:CCGGGCTGTTCATGCCAAGACCGAACTCGAGTTCGGTCTTGGCATGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032589.2-337s1c1
Sequence:CCGGGAAATCAAGAAAGTTCTGGAACTCGAGTTCCAGAACTTTCTTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032589
DSCR8 MISSION shRNA Lentiviral Transduction Particles
Down syndrome critical region gene 8
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000122462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032589.2-365s1c1
Sequence:CCGGGCTGTTCATGCCAAGACCGAACTCGAGTTCGGTCTTGGCATGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032589.2-337s1c1
Sequence:CCGGGAAATCAAGAAAGTTCTGGAACTCGAGTTCCAGAACTTTCTTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203429
DSCR8 MISSION shRNA Bacterial Glycerol Stock
Down syndrome critical region gene 8
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115747    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203429.1-444s1c1
Sequence:CCGGGCACAACATAATGATGGTTAACTCGAGTTAACCATCATTATGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203429.1-177s1c1
Sequence:CCGGACTGTGAGAAAGGGTCTTCATCTCGAGATGAAGACCCTTTCTCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203429.1-182s1c1
Sequence:CCGGGAGAAAGGGTCTTCATTCATTCTCGAGAATGAATGAAGACCCTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203429.1-198s1c1
Sequence:CCGGTCATTCAAGATGGCATTTGTTCTCGAGAACAAATGCCATCTTGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203429.1-194s1c1
Sequence:CCGGTCATTCATTCAAGATGGCATTCTCGAGAATGCCATCTTGAATGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203429
DSCR8 MISSION shRNA shRNA Plasmid DNA
Down syndrome critical region gene 8
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115747    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203429.1-444s1c1
Sequence:CCGGGCACAACATAATGATGGTTAACTCGAGTTAACCATCATTATGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203429.1-177s1c1
Sequence:CCGGACTGTGAGAAAGGGTCTTCATCTCGAGATGAAGACCCTTTCTCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203429.1-182s1c1
Sequence:CCGGGAGAAAGGGTCTTCATTCATTCTCGAGAATGAATGAAGACCCTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203429.1-198s1c1
Sequence:CCGGTCATTCAAGATGGCATTTGTTCTCGAGAACAAATGCCATCTTGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203429.1-194s1c1
Sequence:CCGGTCATTCATTCAAGATGGCATTCTCGAGAATGCCATCTTGAATGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203429
DSCR8 MISSION shRNA Lentiviral Transduction Particles
Down syndrome critical region gene 8
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115747    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203429.1-444s1c1
Sequence:CCGGGCACAACATAATGATGGTTAACTCGAGTTAACCATCATTATGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203429.1-177s1c1
Sequence:CCGGACTGTGAGAAAGGGTCTTCATCTCGAGATGAAGACCCTTTCTCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203429.1-182s1c1
Sequence:CCGGGAGAAAGGGTCTTCATTCATTCTCGAGAATGAATGAAGACCCTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203429.1-198s1c1
Sequence:CCGGTCATTCAAGATGGCATTTGTTCTCGAGAACAAATGCCATCTTGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203429.1-194s1c1
Sequence:CCGGTCATTCATTCAAGATGGCATTCTCGAGAATGCCATCTTGAATGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks