EMAIL THIS PAGE TO A FRIEND

DSCR9

Down syndrome critical region gene 9 (non-protein coding)

16 Gene Product Result for
Synonyms: NCRNA00038
Species: Human DSCR9(257203)
UniProtKB ID: P59020, B2R8P8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_148675 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_148675 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_148675 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_148675 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148675 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090539 predicted 1153
2 SASI_Hs01_00090540 predicted 1206
3 SASI_Hs01_00090541 predicted 1376
4 SASI_Hs01_00090542 predicted 1359
5 SASI_Hs01_00090543 predicted 1274
6 SASI_Hs01_00090544 predicted 1158
7 SASI_Hs01_00090545 predicted 1362
8 SASI_Hs01_00090546 predicted 1355
9 SASI_Hs01_00090547 predicted 1322
10 SASI_Hs01_00090548 predicted 1272
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148675
DSCR9 MISSION shRNA Bacterial Glycerol Stock
Down syndrome critical region gene 9 (non-protein coding)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148675.2-1420s1c1
Sequence:CCGGGATTCAGATTCAGACACAGGACTCGAGTCCTGTGTCTGAATCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148675.2-1418s1c1
Sequence:CCGGGTGATTCAGATTCAGACACAGCTCGAGCTGTGTCTGAATCTGAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152774    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148675.2-1453s1c1
Sequence:CCGGGTAGAAATGGACTGGAAGGTTCTCGAGAACCTTCCAGTCCATTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148675.2-1424s1c1
Sequence:CCGGCAGATTCAGACACAGGAATTACTCGAGTAATTCCTGTGTCTGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148675.2-1411s1c1
Sequence:CCGGGAAGAAGGTGATTCAGATTCACTCGAGTGAATCTGAATCACCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148675.2-1426s1c1
Sequence:CCGGGATTCAGACACAGGAATTATGCTCGAGCATAATTCCTGTGTCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148675.2-1335s1c1
Sequence:CCGGGAACTGAGAACACCAGCATCTCTCGAGAGATGCTGGTGTTCTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148675.2-1367s1c1
Sequence:CCGGGAATCAGCGTTAGCATGTGGACTCGAGTCCACATGCTAACGCTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148675.2-1324s1c1
Sequence:CCGGGAAGCAGGAAGGAACTGAGAACTCGAGTTCTCAGTTCCTTCCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148675
DSCR9 MISSION shRNA shRNA Plasmid DNA
Down syndrome critical region gene 9 (non-protein coding)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148675.2-1420s1c1
Sequence:CCGGGATTCAGATTCAGACACAGGACTCGAGTCCTGTGTCTGAATCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148675.2-1418s1c1
Sequence:CCGGGTGATTCAGATTCAGACACAGCTCGAGCTGTGTCTGAATCTGAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152774    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148675.2-1453s1c1
Sequence:CCGGGTAGAAATGGACTGGAAGGTTCTCGAGAACCTTCCAGTCCATTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148675.2-1424s1c1
Sequence:CCGGCAGATTCAGACACAGGAATTACTCGAGTAATTCCTGTGTCTGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148675.2-1411s1c1
Sequence:CCGGGAAGAAGGTGATTCAGATTCACTCGAGTGAATCTGAATCACCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148675.2-1426s1c1
Sequence:CCGGGATTCAGACACAGGAATTATGCTCGAGCATAATTCCTGTGTCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148675.2-1335s1c1
Sequence:CCGGGAACTGAGAACACCAGCATCTCTCGAGAGATGCTGGTGTTCTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148675.2-1367s1c1
Sequence:CCGGGAATCAGCGTTAGCATGTGGACTCGAGTCCACATGCTAACGCTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148675.2-1324s1c1
Sequence:CCGGGAAGCAGGAAGGAACTGAGAACTCGAGTTCTCAGTTCCTTCCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148675
DSCR9 MISSION shRNA Lentiviral Transduction Particles
Down syndrome critical region gene 9 (non-protein coding)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148675.2-1420s1c1
Sequence:CCGGGATTCAGATTCAGACACAGGACTCGAGTCCTGTGTCTGAATCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148675.2-1418s1c1
Sequence:CCGGGTGATTCAGATTCAGACACAGCTCGAGCTGTGTCTGAATCTGAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152774    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148675.2-1453s1c1
Sequence:CCGGGTAGAAATGGACTGGAAGGTTCTCGAGAACCTTCCAGTCCATTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148675.2-1424s1c1
Sequence:CCGGCAGATTCAGACACAGGAATTACTCGAGTAATTCCTGTGTCTGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148675.2-1411s1c1
Sequence:CCGGGAAGAAGGTGATTCAGATTCACTCGAGTGAATCTGAATCACCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148675.2-1426s1c1
Sequence:CCGGGATTCAGACACAGGAATTATGCTCGAGCATAATTCCTGTGTCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148675.2-1335s1c1
Sequence:CCGGGAACTGAGAACACCAGCATCTCTCGAGAGATGCTGGTGTTCTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148675.2-1367s1c1
Sequence:CCGGGAATCAGCGTTAGCATGTGGACTCGAGTCCACATGCTAACGCTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148675.2-1324s1c1
Sequence:CCGGGAAGCAGGAAGGAACTGAGAACTCGAGTTCTCAGTTCCTTCCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks