EMAIL THIS PAGE TO A FRIEND

DSE

dermatan sulfate epimerase

77 Gene Product Result for
Synonyms: DSEP DSEPI SART-2 SART2
UniProtKB ID: Q9UL01, Q5R3K6
Gene ID:
Human(29940) Summary: The protein encoded by this gene is a tumor-rejection antigen. This antigen possesses tumor epitopes capable of inducing HLA-A24-restricted and tumor-specific cytotoxic T lymphocytes in cancer patients and may be useful for specific immunotherapy. This gene product is localized to the endoplasmic reticulum. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(212898) dermatan sulfate epimerase
Rat(365583) dermatan sulfate epimerase
Zebrafish(568713) dermatan sulfate epimerase
domestic cat(101089441) dermatan sulfate epimerase
cow(514028) dermatan sulfate epimerase
Horse(100072666) dermatan sulfate epimerase
dog(476271) dermatan sulfate epimerase
chicken(421745) dermatan sulfate epimerase
sheep(101105922) dermatan sulfate epimerase
Domestic Rabbit(100357395) dermatan sulfate epimerase
naked mole-rat(101706845) dermatan sulfate epimerase
domestic guinea pig(100712994) dermatan sulfate epimerase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013352 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013352 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013352 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172508 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172508 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172508 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080976 Rosetta Predictions human pricing
NM_013352 Rosetta Predictions human pricing
NM_001108933 Rosetta Predictions rat pricing
NM_172508 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080976 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316247 predicted 1603
2 SASI_Hs02_00316248 predicted 2105
3 SASI_Hs02_00316249 predicted 847
4 SASI_Hs02_00316250 predicted 607
5 SASI_Hs02_00316251 predicted 1718
6 SASI_Hs02_00316252 predicted 2674
7 SASI_Hs02_00316253 predicted 2047
8 SASI_Hs02_00316254 predicted 2195
9 SASI_Hs02_00316255 predicted 500
10 SASI_Hs02_00316256 predicted 1696
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013352 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344668 predicted 1635
2 SASI_Hs02_00344669 predicted 2145
3 SASI_Hs02_00344670 predicted 881
4 SASI_Hs01_00205463 predicted 647
5 SASI_Hs01_00205464 predicted 1754
6 SASI_Hs01_00205465 predicted 2705
7 SASI_Hs01_00205467 predicted 2086
8 SASI_Hs02_00344671 predicted 2221
9 SASI_Hs02_00344672 predicted 530
10 SASI_Hs02_00344673 predicted 1729
11 SASI_Hs01_00205461 predicted 947
12 SASI_Hs01_00205462 predicted 1074
13 SASI_Hs01_00205466 predicted 1125
14 SASI_Hs01_00205468 predicted 1085
15 SASI_Hs01_00205469 predicted 1157
16 SASI_Hs01_00205470 predicted 625
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108933 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243514 predicted 1993
2 SASI_Rn02_00243515 predicted 1597
3 SASI_Rn02_00243516 predicted 3024
4 SASI_Rn02_00243517 predicted 1282
5 SASI_Rn02_00243518 predicted 1465
6 SASI_Rn02_00243519 predicted 3363
7 SASI_Rn02_00243520 predicted 1417
8 SASI_Rn02_00243521 predicted 683
9 SASI_Rn02_00243522 predicted 3433
10 SASI_Rn02_00243523 predicted 2986
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172508 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044923 predicted 3272
2 SASI_Mm01_00044924 predicted 3056
3 SASI_Mm01_00044925 predicted 1312
4 SASI_Mm01_00044926 predicted 3016
5 SASI_Mm02_00344097 predicted 1533
6 SASI_Mm01_00044928 predicted 1792
7 SASI_Mm01_00044929 predicted 1636
8 SASI_Mm01_00044931 predicted 1005
9 SASI_Mm01_00044932 predicted 1956
10 SASI_Mm02_00344098 predicted 1083
11 SASI_Mm01_00044927 predicted 1051
12 SASI_Mm01_00044930 predicted 1404
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013352
VALIDATED
DSE MISSION shRNA Bacterial Glycerol Stock
dermatan sulfate epimerase
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_013352.1-1120s1c1
Sequence:CCGGGCCAATTAGTGTTCCTTGATACTCGAGTATCAAGGAACACTAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144581    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013352.1-3583s1c1
Sequence:CCGGGCTATTCAGATAACATGGCAACTCGAGTTGCCATGTTATCTGAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_013352.1-3272s1c1
Sequence:CCGGGCAGTCCATATAGTACTACTTCTCGAGAAGTAGTACTATATGGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013352.1-2553s1c1
Sequence:CCGGCAGCAAAGCAAGTCAAAGAAACTCGAGTTTCTTTGACTTGCTTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013352.1-2682s1c1
Sequence:CCGGCAGAAAGAACTACCCATAGATCTCGAGATCTATGGGTAGTTCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122101    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_013352.1-3797s1c1
Sequence:CCGGCCCAATAACAACTAAACCTTTCTCGAGAAAGGTTTAGTTGTTATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_013352.1-1121s1c1
Sequence:CCGGCCAATTAGTGTTCCTTGATAACTCGAGTTATCAAGGAACACTAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013352.1-2861s1c1
Sequence:CCGGCCTGATTCTGAACATTGCTATCTCGAGATAGCAATGTTCAGAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_013352.1-3705s1c1
Sequence:CCGGGCTTGGTTACTTGCATGCATTCTCGAGAATGCATGCAAGTAACCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_013352.1-1571s1c1
Sequence:CCGGGCCAAAGTACACCTTCTTCAACTCGAGTTGAAGAAGGTGTACTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013352.2-3784s21c1
Sequence:CCGGGCTTGGTTACTTGCATGCATTCTCGAGAATGCATGCAAGTAACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013352.2-1199s21c1
Sequence:CCGGGCCAATTAGTGTTCCTTGATACTCGAGTATCAAGGAACACTAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013352.2-2761s21c1
Sequence:CCGGCAGAAAGAACTACCCATAGATCTCGAGATCTATGGGTAGTTCTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013352.2-3351s21c1
Sequence:CCGGGCAGTCCATATAGTACTACTTCTCGAGAAGTAGTACTATATGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013352.2-1650s21c1
Sequence:CCGGGCCAAAGTACACCTTCTTCAACTCGAGTTGAAGAAGGTGTACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013352
VALIDATED
DSE MISSION shRNA shRNA Plasmid DNA
dermatan sulfate epimerase
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_013352.1-1120s1c1
Sequence:CCGGGCCAATTAGTGTTCCTTGATACTCGAGTATCAAGGAACACTAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144581    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013352.1-3583s1c1
Sequence:CCGGGCTATTCAGATAACATGGCAACTCGAGTTGCCATGTTATCTGAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_013352.1-3272s1c1
Sequence:CCGGGCAGTCCATATAGTACTACTTCTCGAGAAGTAGTACTATATGGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013352.1-2553s1c1
Sequence:CCGGCAGCAAAGCAAGTCAAAGAAACTCGAGTTTCTTTGACTTGCTTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013352.1-2682s1c1
Sequence:CCGGCAGAAAGAACTACCCATAGATCTCGAGATCTATGGGTAGTTCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122101    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_013352.1-3797s1c1
Sequence:CCGGCCCAATAACAACTAAACCTTTCTCGAGAAAGGTTTAGTTGTTATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_013352.1-1121s1c1
Sequence:CCGGCCAATTAGTGTTCCTTGATAACTCGAGTTATCAAGGAACACTAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013352.1-2861s1c1
Sequence:CCGGCCTGATTCTGAACATTGCTATCTCGAGATAGCAATGTTCAGAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_013352.1-3705s1c1
Sequence:CCGGGCTTGGTTACTTGCATGCATTCTCGAGAATGCATGCAAGTAACCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_013352.1-1571s1c1
Sequence:CCGGGCCAAAGTACACCTTCTTCAACTCGAGTTGAAGAAGGTGTACTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013352.2-3784s21c1
Sequence:CCGGGCTTGGTTACTTGCATGCATTCTCGAGAATGCATGCAAGTAACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013352.2-1199s21c1
Sequence:CCGGGCCAATTAGTGTTCCTTGATACTCGAGTATCAAGGAACACTAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013352.2-2761s21c1
Sequence:CCGGCAGAAAGAACTACCCATAGATCTCGAGATCTATGGGTAGTTCTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013352.2-3351s21c1
Sequence:CCGGGCAGTCCATATAGTACTACTTCTCGAGAAGTAGTACTATATGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013352.2-1650s21c1
Sequence:CCGGGCCAAAGTACACCTTCTTCAACTCGAGTTGAAGAAGGTGTACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013352
VALIDATED
DSE MISSION shRNA Lentiviral Transduction Particles
dermatan sulfate epimerase
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_013352.1-1120s1c1
Sequence:CCGGGCCAATTAGTGTTCCTTGATACTCGAGTATCAAGGAACACTAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144581    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013352.1-3583s1c1
Sequence:CCGGGCTATTCAGATAACATGGCAACTCGAGTTGCCATGTTATCTGAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_013352.1-3272s1c1
Sequence:CCGGGCAGTCCATATAGTACTACTTCTCGAGAAGTAGTACTATATGGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013352.1-2553s1c1
Sequence:CCGGCAGCAAAGCAAGTCAAAGAAACTCGAGTTTCTTTGACTTGCTTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013352.1-2682s1c1
Sequence:CCGGCAGAAAGAACTACCCATAGATCTCGAGATCTATGGGTAGTTCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122101    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_013352.1-3797s1c1
Sequence:CCGGCCCAATAACAACTAAACCTTTCTCGAGAAAGGTTTAGTTGTTATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_013352.1-1121s1c1
Sequence:CCGGCCAATTAGTGTTCCTTGATAACTCGAGTTATCAAGGAACACTAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013352.1-2861s1c1
Sequence:CCGGCCTGATTCTGAACATTGCTATCTCGAGATAGCAATGTTCAGAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_013352.1-3705s1c1
Sequence:CCGGGCTTGGTTACTTGCATGCATTCTCGAGAATGCATGCAAGTAACCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_013352.1-1571s1c1
Sequence:CCGGGCCAAAGTACACCTTCTTCAACTCGAGTTGAAGAAGGTGTACTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013352.2-3784s21c1
Sequence:CCGGGCTTGGTTACTTGCATGCATTCTCGAGAATGCATGCAAGTAACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013352.2-1199s21c1
Sequence:CCGGGCCAATTAGTGTTCCTTGATACTCGAGTATCAAGGAACACTAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013352.2-2761s21c1
Sequence:CCGGCAGAAAGAACTACCCATAGATCTCGAGATCTATGGGTAGTTCTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013352.2-3351s21c1
Sequence:CCGGGCAGTCCATATAGTACTACTTCTCGAGAAGTAGTACTATATGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013352.2-1650s21c1
Sequence:CCGGGCCAAAGTACACCTTCTTCAACTCGAGTTGAAGAAGGTGTACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172508
VALIDATED
DSE MISSION shRNA Bacterial Glycerol Stock
dermatan sulfate epimerase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172508.2-2451s1c1
Sequence:CCGGCGGGACAAATTATGTGAATGTCTCGAGACATTCACATAATTTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172508.2-3270s1c1
Sequence:CCGGGCTGGCAATGCAACTGACTTACTCGAGTAAGTCAGTTGCATTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172508.2-1076s1c1
Sequence:CCGGCCTCGGGCTATATGTATGAAACTCGAGTTTCATACATATAGCCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172508.2-1947s1c1
Sequence:CCGGGCCAAAGTACACCTACTTTAACTCGAGTTAAAGTAGGTGTACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125219    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172508.2-3484s1c1
Sequence:CCGGCCAGATTTACTTGAGCAAATTCTCGAGAATTTGCTCAAGTAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172508
VALIDATED
DSE MISSION shRNA shRNA Plasmid DNA
dermatan sulfate epimerase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172508.2-2451s1c1
Sequence:CCGGCGGGACAAATTATGTGAATGTCTCGAGACATTCACATAATTTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172508.2-3270s1c1
Sequence:CCGGGCTGGCAATGCAACTGACTTACTCGAGTAAGTCAGTTGCATTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172508.2-1076s1c1
Sequence:CCGGCCTCGGGCTATATGTATGAAACTCGAGTTTCATACATATAGCCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172508.2-1947s1c1
Sequence:CCGGGCCAAAGTACACCTACTTTAACTCGAGTTAAAGTAGGTGTACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125219    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172508.2-3484s1c1
Sequence:CCGGCCAGATTTACTTGAGCAAATTCTCGAGAATTTGCTCAAGTAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172508
VALIDATED
DSE MISSION shRNA Lentiviral Transduction Particles
dermatan sulfate epimerase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172508.2-2451s1c1
Sequence:CCGGCGGGACAAATTATGTGAATGTCTCGAGACATTCACATAATTTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172508.2-3270s1c1
Sequence:CCGGGCTGGCAATGCAACTGACTTACTCGAGTAAGTCAGTTGCATTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172508.2-1076s1c1
Sequence:CCGGCCTCGGGCTATATGTATGAAACTCGAGTTTCATACATATAGCCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172508.2-1947s1c1
Sequence:CCGGGCCAAAGTACACCTACTTTAACTCGAGTTAAAGTAGGTGTACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125219    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172508.2-3484s1c1
Sequence:CCGGCCAGATTTACTTGAGCAAATTCTCGAGAATTTGCTCAAGTAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks