EMAIL THIS PAGE TO A FRIEND

DSEL

dermatan sulfate epimerase-like

183 Gene Product Result for
Synonyms: C18orf4
UniProtKB ID: Q8IZU8, Q17RH1, Q6P5Z3
Gene ID:
Mouse(319901) dermatan sulfate epimerase-like
Rat(297865) dermatan sulfate epimerase-like
domestic guinea pig(100734050) dermatan sulfate epimerase-like
naked mole-rat(101708834) dermatan sulfate epimerase-like
sheep(101103774) dermatan sulfate epimerase-like
Domestic Rabbit(100341351) dermatan sulfate epimerase-like
Zebrafish(568099) dermatan sulfate epimerase-like
chicken(421028) dermatan sulfate epimerase-like
cow(538958) dermatan sulfate epimerase-like
Horse(100051845) dermatan sulfate epimerase-like
dog(483944) dermatan sulfate epimerase-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA060942 Anti-DSEL antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081316 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081316 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081316 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032160 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032160 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032160 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032160 Rosetta Predictions human pricing
XM_001058721 Rosetta Predictions rat pricing
XM_232716 Rosetta Predictions rat pricing
NM_001081316 Rosetta Predictions mouse pricing
XM_892762 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032160 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141723 predicted 1622
2 SASI_Hs01_00141724 predicted 3524
3 SASI_Hs01_00141725 predicted 2728
4 SASI_Hs02_00359400 predicted 4191
5 SASI_Hs01_00141726 predicted 1754
6 SASI_Hs01_00141727 predicted 4605
7 SASI_Hs02_00359401 predicted 1804
8 SASI_Hs02_00359402 predicted 2455
9 SASI_Hs01_00141729 predicted 1998
10 SASI_Hs02_00359403 predicted 3962
11 SASI_Hs01_00141722 predicted 1432
12 SASI_Hs01_00141728 predicted 3912
13 SASI_Hs01_00141730 predicted 4407
14 SASI_Hs01_00141731 predicted 3267
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058721 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00290649 predicted 2490
2 SASI_Rn02_00290650 predicted 308
3 SASI_Rn02_00290651 predicted 2347
4 SASI_Rn02_00290652 predicted 722
5 SASI_Rn02_00290653 predicted 744
6 SASI_Rn02_00290654 predicted 2100
7 SASI_Rn02_00290655 predicted 3194
8 SASI_Rn02_00290656 predicted 1915
9 SASI_Rn02_00290657 predicted 2907
10 SASI_Rn02_00290658 predicted 3005
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_232716 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387202 predicted 3753
2 SASI_Rn02_00387203 predicted 2495
3 SASI_Rn02_00387204 predicted 2345
4 SASI_Rn02_00387205 predicted 2094
5 SASI_Rn02_00387206 predicted 2284
6 SASI_Rn02_00387207 predicted 3192
7 SASI_Rn02_00387208 predicted 1913
8 SASI_Rn02_00387209 predicted 2909
9 SASI_Rn02_00387210 predicted 3003
10 SASI_Rn02_00387211 predicted 1422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081316 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297221 predicted 2350
2 SASI_Mm02_00297222 predicted 3351
3 SASI_Mm02_00297223 predicted 4477
4 SASI_Mm02_00297224 predicted 3874
5 SASI_Mm02_00297225 predicted 4448
6 SASI_Mm02_00297226 predicted 4761
7 SASI_Mm02_00297227 predicted 3483
8 SASI_Mm02_00297228 predicted 3276
9 SASI_Mm02_00297229 predicted 1766
10 SASI_Mm02_00297230 predicted 4297
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_892762 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00260836 predicted 1886
2 SASI_Mm01_00260837 predicted 2350
3 SASI_Mm01_00260838 predicted 5320
4 SASI_Mm01_00260839 predicted 4481
5 SASI_Mm01_00260840 predicted 3875
6 SASI_Mm01_00260841 predicted 4764
7 SASI_Mm01_00260842 predicted 3483
8 SASI_Mm01_00260843 predicted 3279
9 SASI_Mm01_00260844 predicted 1776
10 SASI_Mm01_00260845 predicted 3005
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081316
DSEL MISSION shRNA Bacterial Glycerol Stock
dermatan sulfate epimerase-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081316.1-4477s21c1
Sequence:CCGGGGAGTAAACTGGCCCAATATTCTCGAGAATATTGGGCCAGTTTACTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081316.1-1730s21c1
Sequence:CCGGAGAATCTGTGAGCAATTATTCCTCGAGGAATAATTGCTCACAGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081316.1-2354s21c1
Sequence:CCGGCTTGGTTACTGGAGTAGATAACTCGAGTTATCTACTCCAGTAACCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252895    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081316.1-5447s21c1
Sequence:CCGGATTTGGCCTAGCAGGATTTATCTCGAGATAAATCCTGCTAGGCCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081316.1-2630s21c1
Sequence:CCGGCATAGCAGATTCCAATTATAACTCGAGTTATAATTGGAATCTGCTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081316
DSEL MISSION shRNA shRNA Plasmid DNA
dermatan sulfate epimerase-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081316.1-4477s21c1
Sequence:CCGGGGAGTAAACTGGCCCAATATTCTCGAGAATATTGGGCCAGTTTACTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081316.1-1730s21c1
Sequence:CCGGAGAATCTGTGAGCAATTATTCCTCGAGGAATAATTGCTCACAGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081316.1-2354s21c1
Sequence:CCGGCTTGGTTACTGGAGTAGATAACTCGAGTTATCTACTCCAGTAACCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252895    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081316.1-5447s21c1
Sequence:CCGGATTTGGCCTAGCAGGATTTATCTCGAGATAAATCCTGCTAGGCCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081316.1-2630s21c1
Sequence:CCGGCATAGCAGATTCCAATTATAACTCGAGTTATAATTGGAATCTGCTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081316
DSEL MISSION shRNA Lentiviral Transduction Particles
dermatan sulfate epimerase-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081316.1-4477s21c1
Sequence:CCGGGGAGTAAACTGGCCCAATATTCTCGAGAATATTGGGCCAGTTTACTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081316.1-1730s21c1
Sequence:CCGGAGAATCTGTGAGCAATTATTCCTCGAGGAATAATTGCTCACAGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081316.1-2354s21c1
Sequence:CCGGCTTGGTTACTGGAGTAGATAACTCGAGTTATCTACTCCAGTAACCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252895    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081316.1-5447s21c1
Sequence:CCGGATTTGGCCTAGCAGGATTTATCTCGAGATAAATCCTGCTAGGCCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081316.1-2630s21c1
Sequence:CCGGCATAGCAGATTCCAATTATAACTCGAGTTATAATTGGAATCTGCTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032160
DSEL MISSION shRNA Bacterial Glycerol Stock
dermatan sulfate epimerase-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032160.1-2263s1c1
Sequence:CCGGGCTGTAGTGGATGTCATGGAACTCGAGTTCCATGACATCCACTACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032160.1-4529s1c1
Sequence:CCGGGCTGGACGTTAAAGCTTCATTCTCGAGAATGAAGCTTTAACGTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032160.1-4828s1c1
Sequence:CCGGGCAGCAGCCTTGAGAATAAATCTCGAGATTTATTCTCAAGGCTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032160.1-1912s1c1
Sequence:CCGGCCAGAAGACAAAGTTGCCTTTCTCGAGAAAGGCAACTTTGTCTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032160.1-2471s1c1
Sequence:CCGGGCTTCCAAAGAACTGTGGGTACTCGAGTACCCACAGTTCTTTGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032160.1-5116s1c1
Sequence:CCGGCGCCTAGGATATCCAAAGTTTCTCGAGAAACTTTGGATATCCTAGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032160.1-2576s1c1
Sequence:CCGGGAAATTGGTTAGCTCAGCAAACTCGAGTTTGCTGAGCTAACCAATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032160.1-1510s1c1
Sequence:CCGGGCGTTAATGTTTACAGGACATCTCGAGATGTCCTGTAAACATTAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032160.1-3778s1c1
Sequence:CCGGCCTGTAAGACATGATAGGATTCTCGAGAATCCTATCATGTCTTACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032160.1-2836s1c1
Sequence:CCGGGCTGTGTATGACATAGTTCATCTCGAGATGAACTATGTCATACACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032160
DSEL MISSION shRNA shRNA Plasmid DNA
dermatan sulfate epimerase-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032160.1-2263s1c1
Sequence:CCGGGCTGTAGTGGATGTCATGGAACTCGAGTTCCATGACATCCACTACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032160.1-4529s1c1
Sequence:CCGGGCTGGACGTTAAAGCTTCATTCTCGAGAATGAAGCTTTAACGTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032160.1-4828s1c1
Sequence:CCGGGCAGCAGCCTTGAGAATAAATCTCGAGATTTATTCTCAAGGCTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032160.1-1912s1c1
Sequence:CCGGCCAGAAGACAAAGTTGCCTTTCTCGAGAAAGGCAACTTTGTCTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032160.1-2471s1c1
Sequence:CCGGGCTTCCAAAGAACTGTGGGTACTCGAGTACCCACAGTTCTTTGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032160.1-5116s1c1
Sequence:CCGGCGCCTAGGATATCCAAAGTTTCTCGAGAAACTTTGGATATCCTAGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032160.1-2576s1c1
Sequence:CCGGGAAATTGGTTAGCTCAGCAAACTCGAGTTTGCTGAGCTAACCAATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032160.1-1510s1c1
Sequence:CCGGGCGTTAATGTTTACAGGACATCTCGAGATGTCCTGTAAACATTAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032160.1-3778s1c1
Sequence:CCGGCCTGTAAGACATGATAGGATTCTCGAGAATCCTATCATGTCTTACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032160.1-2836s1c1
Sequence:CCGGGCTGTGTATGACATAGTTCATCTCGAGATGAACTATGTCATACACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032160
DSEL MISSION shRNA Lentiviral Transduction Particles
dermatan sulfate epimerase-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032160.1-2263s1c1
Sequence:CCGGGCTGTAGTGGATGTCATGGAACTCGAGTTCCATGACATCCACTACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032160.1-4529s1c1
Sequence:CCGGGCTGGACGTTAAAGCTTCATTCTCGAGAATGAAGCTTTAACGTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032160.1-4828s1c1
Sequence:CCGGGCAGCAGCCTTGAGAATAAATCTCGAGATTTATTCTCAAGGCTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032160.1-1912s1c1
Sequence:CCGGCCAGAAGACAAAGTTGCCTTTCTCGAGAAAGGCAACTTTGTCTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032160.1-2471s1c1
Sequence:CCGGGCTTCCAAAGAACTGTGGGTACTCGAGTACCCACAGTTCTTTGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032160.1-5116s1c1
Sequence:CCGGCGCCTAGGATATCCAAAGTTTCTCGAGAAACTTTGGATATCCTAGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032160.1-2576s1c1
Sequence:CCGGGAAATTGGTTAGCTCAGCAAACTCGAGTTTGCTGAGCTAACCAATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032160.1-1510s1c1
Sequence:CCGGGCGTTAATGTTTACAGGACATCTCGAGATGTCCTGTAAACATTAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032160.1-3778s1c1
Sequence:CCGGCCTGTAAGACATGATAGGATTCTCGAGAATCCTATCATGTCTTACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032160.1-2836s1c1
Sequence:CCGGGCTGTGTATGACATAGTTCATCTCGAGATGAACTATGTCATACACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)