EMAIL THIS PAGE TO A FRIEND

DSG1

desmoglein 1

134 Gene Product Result for
Synonyms: CDHF4 DG1 DSG PPKS1 SPPK1
UniProtKB ID: Q02413
Gene ID:
Human(1828) Summary: Desmosomes are cell-cell junctions between epithelial, myocardial and certain other cell types. Desmoglein 1 is a calcium-binding transmembrane glycoprotein component of desmosomes in vertebrate epithelial cells. Currently, three desmoglein subfamily members have been identified and all are members of the cadherin cell adhesion molecule superfamily. These desmoglein gene family members are located in a cluster on chromosome 18. The protein encoded by this gene has been identified as the autoantigen of the autoimmune skin blistering disease pemphigus foliaceus. [provided by RefSeq, Jul 2008]
Rat(291755) desmoglein 1
cow(281131) desmoglein 1
dog(403401) desmoglein 1
sheep(101115499) desmoglein 1
Gene Class: Cell_Adhesion
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001942 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001942 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001942 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036261 MISSION® esiRNA esiRNA human DSG1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001942 Rosetta Predictions human pricing
XM_214616 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001942 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053795 predicted 2092
2 SASI_Hs01_00053796 predicted 2573
3 SASI_Hs01_00053797 predicted 489
4 SASI_Hs01_00053798 predicted 741
5 SASI_Hs02_00332851 predicted 1458
6 SASI_Hs01_00053800 predicted 1008
7 SASI_Hs02_00332852 predicted 2823
8 SASI_Hs01_00053801 predicted 2938
9 SASI_Hs01_00053802 predicted 1676
10 SASI_Hs01_00053803 predicted 2309
11 SASI_Hs01_00053799 predicted 829
12 SASI_Hs01_00053804 predicted 2951
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214616 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375435 predicted 638
2 SASI_Rn02_00375436 predicted 1848
3 SASI_Rn02_00375437 predicted 2214
4 SASI_Rn02_00375438 predicted 2294
5 SASI_Rn02_00375439 predicted 1004
6 SASI_Rn02_00375440 predicted 1827
7 SASI_Rn02_00375441 predicted 675
8 SASI_Rn02_00375442 predicted 1028
9 SASI_Rn02_00375443 predicted 327
10 SASI_Rn02_00375444 predicted 552
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001942
DSG1 MISSION shRNA Bacterial Glycerol Stock
desmoglein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001942.1-323s1c1
Sequence:CCGGGCACCATCAAATGGCATTCAACTCGAGTTGAATGCCATTTGATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001942.1-453s1c1
Sequence:CCGGCCAGCAAGTTACATACCGCATCTCGAGATGCGGTATGTAACTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001942.1-905s1c1
Sequence:CCGGGCCAGTATGCTCTTGCTGTAACTCGAGTTACAGCAAGAGCATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001942.1-3319s1c1
Sequence:CCGGCGAAGTCGAATCACAAAGTATCTCGAGATACTTTGTGATTCGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001942.1-964s1c1
Sequence:CCGGGCGGAATGTGAGTGCAACATTCTCGAGAATGTTGCACTCACATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001942.2-2822s21c1
Sequence:CCGGCCCAATCTCTGGCGCTGATTTCTCGAGAAATCAGCGCCAGAGATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001942.2-2175s21c1
Sequence:CCGGGAACTAACAGAGGGAGTTAAACTCGAGTTTAACTCCCTCTGTTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001942.2-2455s21c1
Sequence:CCGGTGGATACCCTGGGACCTAAATCTCGAGATTTAGGTCCCAGGGTATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001942.2-1395s21c1
Sequence:CCGGACTGGTAATATGGGATCAAATCTCGAGATTTGATCCCATATTACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001942
DSG1 MISSION shRNA shRNA Plasmid DNA
desmoglein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001942.1-323s1c1
Sequence:CCGGGCACCATCAAATGGCATTCAACTCGAGTTGAATGCCATTTGATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001942.1-453s1c1
Sequence:CCGGCCAGCAAGTTACATACCGCATCTCGAGATGCGGTATGTAACTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001942.1-905s1c1
Sequence:CCGGGCCAGTATGCTCTTGCTGTAACTCGAGTTACAGCAAGAGCATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001942.1-3319s1c1
Sequence:CCGGCGAAGTCGAATCACAAAGTATCTCGAGATACTTTGTGATTCGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001942.1-964s1c1
Sequence:CCGGGCGGAATGTGAGTGCAACATTCTCGAGAATGTTGCACTCACATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001942.2-2822s21c1
Sequence:CCGGCCCAATCTCTGGCGCTGATTTCTCGAGAAATCAGCGCCAGAGATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001942.2-2175s21c1
Sequence:CCGGGAACTAACAGAGGGAGTTAAACTCGAGTTTAACTCCCTCTGTTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001942.2-2455s21c1
Sequence:CCGGTGGATACCCTGGGACCTAAATCTCGAGATTTAGGTCCCAGGGTATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001942.2-1395s21c1
Sequence:CCGGACTGGTAATATGGGATCAAATCTCGAGATTTGATCCCATATTACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001942
DSG1 MISSION shRNA Lentiviral Transduction Particles
desmoglein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001942.1-323s1c1
Sequence:CCGGGCACCATCAAATGGCATTCAACTCGAGTTGAATGCCATTTGATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001942.1-453s1c1
Sequence:CCGGCCAGCAAGTTACATACCGCATCTCGAGATGCGGTATGTAACTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001942.1-905s1c1
Sequence:CCGGGCCAGTATGCTCTTGCTGTAACTCGAGTTACAGCAAGAGCATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001942.1-3319s1c1
Sequence:CCGGCGAAGTCGAATCACAAAGTATCTCGAGATACTTTGTGATTCGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001942.1-964s1c1
Sequence:CCGGGCGGAATGTGAGTGCAACATTCTCGAGAATGTTGCACTCACATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001942.2-2822s21c1
Sequence:CCGGCCCAATCTCTGGCGCTGATTTCTCGAGAAATCAGCGCCAGAGATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001942.2-2175s21c1
Sequence:CCGGGAACTAACAGAGGGAGTTAAACTCGAGTTTAACTCCCTCTGTTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001942.2-2455s21c1
Sequence:CCGGTGGATACCCTGGGACCTAAATCTCGAGATTTAGGTCCCAGGGTATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001942.2-1395s21c1
Sequence:CCGGACTGGTAATATGGGATCAAATCTCGAGATTTGATCCCATATTACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks