EMAIL THIS PAGE TO A FRIEND

DSG2

desmoglein 2

67 Gene Product Result for
Synonyms: ARVC10 ARVD10 CDHF5 CMD1BB HDGC
UniProtKB ID: Q14126, Q4KKU6
Gene ID:
Human(1829) Summary: Desmosomes are cell-cell junctions between epithelial, myocardial, and certain other cell types. This gene product is a calcium-binding transmembrane glycoprotein component of desmosomes in vertebrate epithelial cells. Currently, three desmoglein subfamily members have been identified and all are members of the cadherin cell adhesion molecule superfamily. These desmoglein gene family members are located in a cluster on chromosome 18. This second family member is expressed in colon, colon carcinoma, and other simple and stratified epithelial-derived cell lines. Mutations in this gene have been associated with arrhythmogenic right ventricular dysplasia, familial, 10. [provided by RefSeq, Jul 2008]
Mouse(13511) desmoglein 2
Rat(307562) desmoglein 2
sheep(101118655) desmoglein 2
Zebrafish(560026) desmoglein 2
chicken(428529) desmoglein 2
cow(508151) desmoglein 2
Horse(100066038) desmoglein 2
dog(490500) desmoglein 2
Gene Class: Cell_Adhesion
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2701981 Anti-DSG2 (N-terminal) antibody produced in rabbit human
immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
SAB2108115 Anti-DSG2 antibody produced in rabbit affinity isolated antibody human, rabbit, horse, guinea pig, rat, mouse
immunohistochemistry, western blot pricing
HPA004896 Anti-DSG2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2100629 Anti-DSG2 antibody produced in rabbit affinity isolated antibody, lyophilized powder human, rat, mouse, horse, rabbit
western blot pricing
SAB4500673 Anti-DSG2 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007883 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007883 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007883 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001943 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001943 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001943 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001943 Rosetta Predictions human pricing
XM_001054396 Rosetta Predictions rat pricing
XM_226112 Rosetta Predictions rat pricing
NM_007883 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001943 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332853 predicted 3221
2 SASI_Hs01_00098887 predicted 1036
3 SASI_Hs01_00098889 predicted 598
4 SASI_Hs01_00098890 predicted 2951
5 SASI_Hs01_00098891 predicted 470
6 SASI_Hs02_00332854 predicted 2641
7 SASI_Hs01_00098892 predicted 458
8 SASI_Hs02_00332855 predicted 625
9 SASI_Hs01_00098894 predicted 1089
10 SASI_Hs02_00332856 predicted 2553
11 SASI_Hs01_00098888 predicted 2496
12 SASI_Hs01_00098893 predicted 560
13 SASI_Hs01_00098895 predicted 1416
14 SASI_Hs01_00098896 predicted 1576
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054396 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00275685 predicted 927
2 SASI_Rn02_00275686 predicted 2945
3 SASI_Rn02_00275687 predicted 1816
4 SASI_Rn02_00275688 predicted 2732
5 SASI_Rn02_00275689 predicted 3696
6 SASI_Rn02_00275690 predicted 3230
7 SASI_Rn02_00275691 predicted 1768
8 SASI_Rn02_00275692 predicted 1429
9 SASI_Rn02_00275693 predicted 3413
10 SASI_Rn02_00275694 predicted 3198
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226112 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383340 predicted 845
2 SASI_Rn02_00383341 predicted 927
3 SASI_Rn02_00383342 predicted 2951
4 SASI_Rn02_00383343 predicted 1822
5 SASI_Rn02_00383344 predicted 2740
6 SASI_Rn02_00383345 predicted 1770
7 SASI_Rn02_00383346 predicted 1434
8 SASI_Rn02_00383347 predicted 1873
9 SASI_Rn02_00383348 predicted 1301
10 SASI_Rn02_00383349 predicted 1472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007883 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061476 predicted 982
2 SASI_Mm01_00061477 predicted 882
3 SASI_Mm01_00061478 predicted 1540
4 SASI_Mm01_00061479 predicted 1356
5 SASI_Mm01_00061480 predicted 477
6 SASI_Mm02_00312669 predicted 1516
7 SASI_Mm01_00061483 predicted 959
8 SASI_Mm01_00061484 predicted 1450
9 SASI_Mm02_00312670 predicted 1085
10 SASI_Mm01_00061485 predicted 2966
11 SASI_Mm01_00061481 predicted 868
12 SASI_Mm01_00061482 predicted 3228
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007883
VALIDATED
DSG2 MISSION shRNA Bacterial Glycerol Stock
desmoglein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007883.1-3647s1c1
Sequence:CCGGGCCACACAAGACTTGCACATTCTCGAGAATGTGCAAGTCTTGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007883.1-3388s1c1
Sequence:CCGGGCTACCAGATTCCCAGTGAAACTCGAGTTTCACTGGGAATCTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007883.1-2505s1c1
Sequence:CCGGGCCGTGAATGAGGAATTCTTACTCGAGTAAGAATTCCTCATTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007883.1-566s1c1
Sequence:CCGGCCGGGAAGAAACACCATATTTCTCGAGAAATATGGTGTTTCTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007883.1-1556s1c1
Sequence:CCGGGCTTGTAAAGATTCCTGACTTCTCGAGAAGTCAGGAATCTTTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007883.2-538s21c1
Sequence:CCGGCCGGGAAGAAACACCATATTTCTCGAGAAATATGGTGTTTCTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007883.2-2477s21c1
Sequence:CCGGGCCGTGAATGAGGAATTCTTACTCGAGTAAGAATTCCTCATTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007883.2-1528s21c1
Sequence:CCGGGCTTGTAAAGATTCCTGACTTCTCGAGAAGTCAGGAATCTTTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007883.2-3360s21c1
Sequence:CCGGGCTACCAGATTCCCAGTGAAACTCGAGTTTCACTGGGAATCTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007883.2-3619s21c1
Sequence:CCGGGCCACACAAGACTTGCACATTCTCGAGAATGTGCAAGTCTTGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007883
VALIDATED
DSG2 MISSION shRNA shRNA Plasmid DNA
desmoglein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007883.1-3647s1c1
Sequence:CCGGGCCACACAAGACTTGCACATTCTCGAGAATGTGCAAGTCTTGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007883.1-3388s1c1
Sequence:CCGGGCTACCAGATTCCCAGTGAAACTCGAGTTTCACTGGGAATCTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007883.1-2505s1c1
Sequence:CCGGGCCGTGAATGAGGAATTCTTACTCGAGTAAGAATTCCTCATTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007883.1-566s1c1
Sequence:CCGGCCGGGAAGAAACACCATATTTCTCGAGAAATATGGTGTTTCTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007883.1-1556s1c1
Sequence:CCGGGCTTGTAAAGATTCCTGACTTCTCGAGAAGTCAGGAATCTTTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007883.2-538s21c1
Sequence:CCGGCCGGGAAGAAACACCATATTTCTCGAGAAATATGGTGTTTCTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007883.2-2477s21c1
Sequence:CCGGGCCGTGAATGAGGAATTCTTACTCGAGTAAGAATTCCTCATTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007883.2-1528s21c1
Sequence:CCGGGCTTGTAAAGATTCCTGACTTCTCGAGAAGTCAGGAATCTTTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007883.2-3360s21c1
Sequence:CCGGGCTACCAGATTCCCAGTGAAACTCGAGTTTCACTGGGAATCTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007883.2-3619s21c1
Sequence:CCGGGCCACACAAGACTTGCACATTCTCGAGAATGTGCAAGTCTTGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007883
VALIDATED
DSG2 MISSION shRNA Lentiviral Transduction Particles
desmoglein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007883.1-3647s1c1
Sequence:CCGGGCCACACAAGACTTGCACATTCTCGAGAATGTGCAAGTCTTGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007883.1-3388s1c1
Sequence:CCGGGCTACCAGATTCCCAGTGAAACTCGAGTTTCACTGGGAATCTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007883.1-2505s1c1
Sequence:CCGGGCCGTGAATGAGGAATTCTTACTCGAGTAAGAATTCCTCATTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007883.1-566s1c1
Sequence:CCGGCCGGGAAGAAACACCATATTTCTCGAGAAATATGGTGTTTCTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007883.1-1556s1c1
Sequence:CCGGGCTTGTAAAGATTCCTGACTTCTCGAGAAGTCAGGAATCTTTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007883.2-538s21c1
Sequence:CCGGCCGGGAAGAAACACCATATTTCTCGAGAAATATGGTGTTTCTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007883.2-2477s21c1
Sequence:CCGGGCCGTGAATGAGGAATTCTTACTCGAGTAAGAATTCCTCATTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007883.2-1528s21c1
Sequence:CCGGGCTTGTAAAGATTCCTGACTTCTCGAGAAGTCAGGAATCTTTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007883.2-3360s21c1
Sequence:CCGGGCTACCAGATTCCCAGTGAAACTCGAGTTTCACTGGGAATCTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007883.2-3619s21c1
Sequence:CCGGGCCACACAAGACTTGCACATTCTCGAGAATGTGCAAGTCTTGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001943
VALIDATED
DSG2 MISSION shRNA Bacterial Glycerol Stock
desmoglein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001943.1-2620s1c1
Sequence:CCGGGTGAGCAAACTATGGTTAATTCTCGAGAATTAACCATAGTTTGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001943.1-352s1c1
Sequence:CCGGGCATTCTTGATCGAGAAGAAACTCGAGTTTCTTCTCGATCAAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001943.1-987s1c1
Sequence:CCGGGCTCAAACTAACGAAGGAATTCTCGAGAATTCCTTCGTTAGTTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001943.1-1590s1c1
Sequence:CCGGCCTTTCAGTTTCTCCGTCATTCTCGAGAATGACGGAGAAACTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001943.1-774s1c1
Sequence:CCGGGCTCAAGTTCAGATTCGTATTCTCGAGAATACGAATCTGAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001943.3-954s21c1
Sequence:CCGGGCTCAAGTTCAGATTCGTATTCTCGAGAATACGAATCTGAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001943.3-1167s21c1
Sequence:CCGGGCTCAAACTAACGAAGGAATTCTCGAGAATTCCTTCGTTAGTTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001943.3-1049s21c1
Sequence:CCGGCGTAGAAGTTACGCGCATAAACTCGAGTTTATGCGCGTAACTTCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001943.3-3874s21c1
Sequence:CCGGGTTCATCAGCCGTCCAGTAAACTCGAGTTTACTGGACGGCTGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001943.3-611s21c1
Sequence:CCGGACCCTTAGAGCTACGCATTAACTCGAGTTAATGCGTAGCTCTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001943
VALIDATED
DSG2 MISSION shRNA shRNA Plasmid DNA
desmoglein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001943.1-2620s1c1
Sequence:CCGGGTGAGCAAACTATGGTTAATTCTCGAGAATTAACCATAGTTTGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001943.1-352s1c1
Sequence:CCGGGCATTCTTGATCGAGAAGAAACTCGAGTTTCTTCTCGATCAAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001943.1-987s1c1
Sequence:CCGGGCTCAAACTAACGAAGGAATTCTCGAGAATTCCTTCGTTAGTTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001943.1-1590s1c1
Sequence:CCGGCCTTTCAGTTTCTCCGTCATTCTCGAGAATGACGGAGAAACTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001943.1-774s1c1
Sequence:CCGGGCTCAAGTTCAGATTCGTATTCTCGAGAATACGAATCTGAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001943.3-954s21c1
Sequence:CCGGGCTCAAGTTCAGATTCGTATTCTCGAGAATACGAATCTGAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001943.3-1167s21c1
Sequence:CCGGGCTCAAACTAACGAAGGAATTCTCGAGAATTCCTTCGTTAGTTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001943.3-1049s21c1
Sequence:CCGGCGTAGAAGTTACGCGCATAAACTCGAGTTTATGCGCGTAACTTCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001943.3-3874s21c1
Sequence:CCGGGTTCATCAGCCGTCCAGTAAACTCGAGTTTACTGGACGGCTGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001943.3-611s21c1
Sequence:CCGGACCCTTAGAGCTACGCATTAACTCGAGTTAATGCGTAGCTCTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001943
VALIDATED
DSG2 MISSION shRNA Lentiviral Transduction Particles
desmoglein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001943.1-2620s1c1
Sequence:CCGGGTGAGCAAACTATGGTTAATTCTCGAGAATTAACCATAGTTTGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001943.1-352s1c1
Sequence:CCGGGCATTCTTGATCGAGAAGAAACTCGAGTTTCTTCTCGATCAAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001943.1-987s1c1
Sequence:CCGGGCTCAAACTAACGAAGGAATTCTCGAGAATTCCTTCGTTAGTTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001943.1-1590s1c1
Sequence:CCGGCCTTTCAGTTTCTCCGTCATTCTCGAGAATGACGGAGAAACTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001943.1-774s1c1
Sequence:CCGGGCTCAAGTTCAGATTCGTATTCTCGAGAATACGAATCTGAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001943.3-954s21c1
Sequence:CCGGGCTCAAGTTCAGATTCGTATTCTCGAGAATACGAATCTGAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001943.3-1167s21c1
Sequence:CCGGGCTCAAACTAACGAAGGAATTCTCGAGAATTCCTTCGTTAGTTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001943.3-1049s21c1
Sequence:CCGGCGTAGAAGTTACGCGCATAAACTCGAGTTTATGCGCGTAACTTCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001943.3-3874s21c1
Sequence:CCGGGTTCATCAGCCGTCCAGTAAACTCGAGTTTACTGGACGGCTGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001943.3-611s21c1
Sequence:CCGGACCCTTAGAGCTACGCATTAACTCGAGTTAATGCGTAGCTCTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks